Description :
From Genome Similarity Track
Location :
contig_4:129766- 131478
Transcript NameFunction/comments
g1302.t1hypothetical protein

Sequence
1712 bases(100 bases per row)
GCTGTGCGTGCTGGTGCATGAATTTCGAGAGTGGAGACGGAGGGTTGATACTGTCATCAAACGCTCCTCCGGCAGGCCCACTGCTCCAAGTTGATGAGGA
GGTGGTCGGACGGTCGCCGTAGTTGCTGCCGTTGCTGCTGTTCTTGCGCGCTAACCAGAGTCGTCGCTTCTTTTCCCAGTTCTGGTCTCGCTTGGAGGAC
GTGAGCGGCGGTTGGGAGCCCCAGGAGCTTGAGCTCGAGCTCGAGCGGGTGCTCGACCGAGAGCTCGGTGTGGGTGACGAAGAGCGGCCGACTTGGCACC
CGTTGGTGGTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGGTTGCTGGCAGTGTGTGCGGTCTGGTACTGGTATGGTTGCTGTTGCTGGTACAT
TTGCTGCGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAACTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTG
CTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGA
GTCCACCACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGG
TGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTT
CTTACTGGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGG
GGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTC
GCCATAGCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATC
CTCAGTCCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGAC
AAGTATGATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTG
ACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCA
GTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGA
AGGTGAATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACT
GACATTGATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAA
CTCGAGGATCAT