Description :
From Genome Similarity Track
Location :
Scaffold_321:12976- 14687
Transcript NameFunction/comments
Phyta_totarag7085eukaryotic translation initiation factor 3 subunit, putative

Sequence
1711 bases(100 bases per row)
CAGTGTGCGCGGGCGCGGGCGCCACAGGAACTGGTAGAAcgtgtccttcttctcctccagaagctgcttgccCTGGAACGTCCACAGCGTGTAGCCGTTG
TCCATAGTGAACTTGTAGTACGAGTTGTCCAGCGGCTGGCACACGGCCGTCGCCACCACACGTCCAGACGGGTCCCACTCGACGTGCGTGCACTTGAAGT
GCTCCTGCACCGTGatgctctgctgctcggtGGCGTCCCAGAACTCGAGCTGGCCGTTGATCTCGCCCAGACCAGCCAGCACGATGTTGTTGCCTAGCGG
CGACCAGTACAGGTGGCTGCAAGCCTTGTCCTTCAGCGTGTATAGCAGCGTCACCTCCTTCGCCGACTTGCTGCCGCCGTCCATGTCGTAGAACGATATG
TtcaggcgctgctggcccTCGCCGTGCACGGTGGCGAAACGCGTGCCCTTAGGCTCCCAGGCGAACGCGACGATGGTGTCCTTgacctccagcatctcga
cAGGCACCAGCTGCTCATGCACACGGAATAGCTCGAAGTTCGTGTACATagtcttcttcgacttggagTGGCGAGTGACCTTGACGCACAGGAACGTGCC
GTTCGGGTGCCAATGCAGCTTGCAGTCGCTCACGTTGAACAGGTTTTTCTGGCGCACCTCGCGGCgcgacggcagctccacTAGCGATACACGGGCGGGC
ACGTTGTTGCTCTCCGGTGCCCAGTAGGCCAGGATCGGGTCGGTCGGCGACCAAAAGAAGTCGTGCACGCCCTCGGCAcgcagcgacttcttctcgagca
gcttcatggacGGCAGCTCGTAGATGCTGATGACGTTAGTGCCGCGACGAGCCACGTACTTGTCGTCCGCGCTCCACTTGAACGGGGTCATGAGGCCCTG
CACCACCTCGCCCTTGGCGCCTGTAGGCTTTCCAGCAGGGAAGGcacgcagcatcttgctggTCTTGACGTCCCAGATGATGATCGCCGAGTCCTGTTCT
GTCTCGCTCAGCGTGATGAGGTAGTTTTCGTTGGGCGAGAACACAGCAAGCTTGACGTTCTTGTGGGCGAACCGACCCACCTTCTCGTACTTGTCGCCGC
CCCAGAGAGCAATGCCCTGCGGGTGGAACGTGGCCAGGTACGTGCCCTGTGGGGACCACAGCACGTACTGCGAGCACCACTGCTTGCCGTTCGTCTTCTC
GCGGTCGCCAGCGTAGTCGAGCTCGACCTCTCCCTTGTCGCTCCAGAAGATCTCGGTCTCGGAGCCGTGACGCAGCACGAACATGTCGCGACGCGTGGGG
TCCGTGAGCCACGTCATGAGGTTCTTGGGctccacgaacttgtccACCTTGGGGGCCACGAACTCTGTGGTCGTCTTCTGGTAGCGCTCGATGTCCTCGT
ACTTGTTCACGATCATCGTGTGGCGCTTGTCCAGTGCGAAGTTGTTGATGGTGCGCACGGCGTCGTTCGCGTGCGCCTCCTGCTCGTactcgacgaaggc
gaagccCGTGGTCTTGCTGTTGGCACCGAAGGGCATGTGGATGTCCACCACGGTACTCACCTGGCCAaagatcttcttcaccacgttcagcagcttgccg
tGCTTGGTCTCGTCCACAACGGGCAGAccacccaccaccacggccatGCTGTAGTCGTTGCAGAAGTCCGCCTCCTCGTGAGCCTTGGTCGTCACCTcat
cctccacctcc