Description :
From Genome Similarity Track
Location :
Scaffold_13:129753- 131465
Transcript NameFunction/comments
Phyra_94166dTDP-4-dehydrorhamnose reductase
Phyra_75474PREDICTED: uncharacterized protein LOC101860584

Sequence
1712 bases(100 bases per row)
CCAAAGTTCATGGAATGGCTGCATCACCAGCTCTTTCAGTCCGGAACTGCTACTGTGCCACTGAAGTTGTGGCGTGACGAGTTTCGCTCTTACCTTTATA
TTCAGGACTTTGTCGCGATCCTCTTCAAGATGCTGTCGGCTCAGGCTGAGACGCCCGCTACTCTTGTCAACGTCGGTGCGTTCGCTCTATTCGATGAACT
TTCGCTTTACAAGACTTGCTAACGTTCGTGCAGGTGGTGTGGAGGCACTTTCACGTGTGGAACTCGCGCACAAGTATCTTGCTGCTTGCACAAGGTACAA
TTCGAAAGCGGTGAATGCAGTAAAGAGAGAGATCGTGCCGACCGCGCGAGCACAAGTCGACTTGGGGTACCCTTCTCCGCTCAACACGAAGCTCAGCACA
GCACGGCTCGCGCACCAACTGCCAACCTTCGCCAGGACATCGACGGATCAATTCCTGGACGAGATTAGCCACAGCTTTCTTGCTTGAAAAGGGAACGCTG
CAATGTTATATGCTCAAGCTAACGATGGGGTAAAGAAAAAGATGACCAGAACGATGCCATCAAGTAGTCGCCATACCTACATACGAAAACGCGCCCCACT
CGCGCAGGTGATAGAGTCATCCAGTTACTGGATCTCCATCACGTTTCCCATGCTCTGCCGCCCTTTCTCGAAAGCTTGCACGATTGGATCCTCATTGTTG
CCCTTGCTGCCAGACGTTGACGTGTAGACGAAGTCCGCGTCACATAGGGCAATCGCGTTACACGCTTGGCTGGGGCTCTTTCCCTTGCGCATGAGCGACA
CCAGCTCATCGAACTTGGAGGAAAGCACGTCGCAACGCGCACGGGGTGGTAGAACCGTGCATATGGTTTCGAGTGTCATCTTCGCTTCACGCAAAGCCTT
CTCATTGTCCTTGGCGCGCTCCAAAAGATCGGCAGTGTACTCGCAGAATAAGCAGCCCACCGACATCGACTTCTCCGCAGGCACCTCCTCCACCGCTGCA
GGACCACACGCTGCGATTCGCGTGCAGATGGTCTCCACATCTTCGTTATTTTTCAGTGAATCAACGATCATGTCCTGGTGCTTCATCAGTAGCTCGCACT
ATTAACGGACAAACACAATTGTTGTCAGGCGCATTGCAACGCAACATATGAAAGGGGCGACTTCTTACCTCGCTGGAATCTGGGATCAAGCGACACACCG
AGTTGATTTCGCGTTCGAATGTTGCCAAGCTGTTAGGACGAGTAATCAAGGACGCAAGCAGCAACGTATTCTGCTGACACGATGCACACCTCGAGGGCAA
GAAGTCCGAGCCCTTAAAGTCAAGCAGGCCCGACACCAGCGAACTGGTACCTTGAGTTGCCGTGCAAAACTTAAGTGTCTGGCAAATTTCTTGCGGCTCC
TTTCCAGCTTGTAAATCGGTCACTGCCTCGTCGAACATCTTAAGGTCATCGTGGCACTGTCATTTAAGCAAACAATATATCAGTATCATCTCACATAGTT
GTACAGAAGACTTCGCTGTTCTGCATCACTTACCGTGTCGTCGGCAGGGAGTAGTTCGCAAACGATGCCTGCAGCCTCTCGCATTTCCTTCACTTGCTCC
GGCTTCTGGTCAAGTGCGTACTTGAGCACAGTGACAATGCCACTGCAGTAGGCACATGTGTTGCTTTCCTCGTCGTTGTCTCGAACGGCGATCATGTCAA
CTGAAGGCATTG