Description :
From Genome Similarity Track
Location :
Scaffold_35:12971- 28359
Transcript NameFunction/comments
Phyag_g905hypothetical protein

Sequence
15388 bases(100 bases per row)
TCTCGTAGTCGAACGGGACGACCGAATAAAGTTGTCCGTCGTTCGATATGGAAGTATAGCTGCTAGCATTTGTCTGGAAAGTCAACACCGATGCGTGATC
CGGGTCTGCAGCGATCACTTGACCTATAAACGTCCCGTTTGGCGCATTCTCGAAAATGGTGAGTGCTCCAGACGCGCCAAAAGTAGGAGCCTCATTGACG
TCAAGTATATCCACCACAACTTGAACTTGTGCGTCCAGGGCTACGGGGTATCCGGGGTCGATGGCGCGCACACCAAACGAATACTGATTCGTATTTTCGT
AGTCCAATATATCCCATTGTACCACAAGTTGGCCTGAACAGCTCTCTAGTCGGAAAGGTAATCCTCCGGCATTTCGATTCACCAGTTCGTATCGTAAGCT
CTCCGTTTGGCCTTTGTCCGGATCAATAGCCTGGATTGGTGTTCCAAAAGGCAAGCCAGCTGCCGAATTCTCAGGTACACTAAATTCGTAGAACGATTGC
TGGAAAACGGGTGGCTCATTCACATCCAGAAGTGTAATCTGAATCTCCTGTTCACTGAACAGACCGCCTTTGTCGGTAACACGCACGCGAACCATGATCA
ACGAATTTTTCTCGAAATCAAATAATGTACTGTTCTCCACCGACAACTTTCCACACGGTGTCAACACAATATCCGTAGAGGGGAAGGCCAATTCAAATGT
AATTTCGTCATTGACATCTGGATCGCTACCAGTGACTTCACCAATCATCGTCCCGATGGCAGGGTTCTCATCAAtttcgaagcagcaactaGTGATGGAG
GGAGCCTCATTGACGTTGTCAACAAAGAGCGAAAGTGTCGCCTCTCCCGTTAAACCTCCGCTGTCCACAACATTTACAACGACTTGAAGAGGCTGGTCCG
CTGGATTGATAGACTCATAGTCAAGTGTTGGGGTTGCTAGTAGCAATTCCCCTGACGATGTGACCTCAAACCAATCGCTCTTCGACCCGTGGATAAAATA
TTCCAACGAATCCGGAAAAGCACCGAAAATGCACAACATACCAGATGAAACTGTGTCAGGAACAGGGAAATCACCGTCTGATTCCTGTAGTACGTACACG
TCGAAACTCATGGAACTTGTACTACTTTGAGCAGTTACCAATTGTCCTTCCACCTTGACAAACGCCATCCGTGATACCCAGTTTGGAATTACATCGGTAT
CCTCCTCAATCAGAACAAATAAACTACCCGAACTCGCCAAATTCAGTGACGCATCCGATAAAGGTACGGATGCCGGGGTGGCCACGATATACGAATCAGC
AAGTAATTCCGGGATATTGATCCACTCAAAATCGGTAAAGTCAGAATAGACTGGCATTTGCGCTTCGAGTTTCGTCACAAAGTTGCCATCTCCTGTTGAT
GAAGCGATCGTCAAAAAGTTtacgtcgtcgtgctctgGATCAGATACATTGACATAGCCCAAGTTTGTACCACTTGGCGTGTTCTCGTCGACACGGTATA
CCTGATCTGTGGGAATAGGCGCCTCGTTAACGTTGTTAACAAACACCCACATTGTTGCAACCGAGGCTGCTTGCCCATCTGAGCATTGAACACTGAGTTC
ATAGACACGTTGCTTCTCGAAGTCGAGATATCCAGTTTCTGCATACATCATTCCGCTTTTCGCTTCGACAACAAAAGCCTGCGTATCGTTTAAAATTGCG
AAAGACAGTTCATCACCGACATCTTCGTCGAAGCAGTGCATAATGCCCATTAATTCCAAATTTCGCGATCCAGGGGAGATATCGTTCTTCGATAATGCGA
ACTCGTTTGCTGTGAAGTTagcaggctgcagcacgggGGGATCATTCACATTTAAGACAGTAACAGGCAGCGTTGTAACAGCTTGAAGATCCGCTCGGTC
ATGTACTGCGACCTCAATTGTCATCAGCGGTGAGACTTCAAAATCTATCATGGATGAGTTAGCTACCGTAACGACCCCAGTTCTTGCATCGACCATAAAT
GCAGAATTTTGGCTTTGCAATGTAAACGTCAACACATCCCCCACGTCCTCATCAACTGCATCGATAGTACCAACAGTTGCCCCCTCCGCACTATTCTCCG
CTATAACCAATGGTAGTTTCCCTGGAATTGTAGGCGCTTCGTTCACGTCGACTACGCTGATCACAATATCGTTGCTACAAGCTAATGATGGACCATCAGG
GGGGACATCGTTCGCTTGATAACGAAAACGATACGCGTTTTGTACTTCAAAGTTGGCGTAGGTCTGTTGATCCGGAGCAAAGTTCACTACTCCAGTTGAA
TAGTCAATGACAAATGTTCGatcgtcagcagcggcgatcAACTGGAACGTGTGCTTCTGACCCACGTCCAAGTCTTGTACTACCACTTGACATAATCCTT
GGGAACCAGGAAGGCCTTTGTAAACTCCAGATACATTTTCCAGAACCCAACATTGAAGAGACGGACAAGTCGGCGAATTATTGTCATCTACAACCGATAT
TTGCAGTCTAGTAAAGTCTGTTAGTCCTGTAGAATCAGTTACAAGCGGCATGAGGTTGTAGGTCGGAGTAGCCGCCGAGTCAAGAACCCCTTTCTGAATC
AATGAGATTATCCCAGAATTCGCATCGATAGCAAACACGCTACTAGCTGTACTAGTGTCAGGGTCGGAAGTGTCCCACGAATATTGCTGTGTATCGTTAA
AGTCCTGATCTGAAGCTTGGAGAATACCAATCAGAGTTCCTCCATCGGCCAGTTCATGGACTGCTAGTGTATACTGATGTGATCCAAATGTGGGTGGCTC
AGGAGCATCTCCCACCAACATGGTAAAGTTAAAAGCTGTTGACGCATTATTAGAAGAAATCAGAGAGCCTTCAATCGTCAGCATTGGCTCCGTCCAAGCT
GAATTCATCTTTGCTAACGATTCGTAGTCGAGAGAAACATCTGTTGTGAAAATTTGGCCGTCGGTATTAATGGCAATAGCATTTGGAATCGGGTGGGAGC
CTTTCAGGGAGAAAATGAATGGATCTGCCTCAGGGTCTGTACCTTGGAGTTGTCCAAGTAGCCGCCCGCTTGCGGTATTTTCGACAATCACAAGATTATT
TGTCGAAGCTTGAAGAAAGACTGGGGGTTCGTTCACATTAAGGACAAAGATGAATACCATCACTGCATCGGAGAGAAATCCTGTGCCCGTATCAGTGACT
GTCAGTTGCACACGTTGAATGTGTGCGACTTCGTAGTCGAAGACGGCTCGAGTGTACGCGAGATTGCAGCTTCGGTCATCGCTTTGAACAATTTGAACGA
AGGGGGCCGGAGATTCGTCAACAGAGTAGTACAGACGCTGGTTGAAGTCCGGATCACACGCTTCAAAGTGGGACAACAGTGATCCGACCGCTAGATCTTC
GCTTGCTTCAAGACACACGTGCTTGTTTTCTTCGTATCGGTCTTCCGTCGTACCATCTTCGCGAACATAACAGTTTCGAGATATCTGTGGGCGCTCATTC
ACATCTATAATTGCGACATGTACCAGTGTCGTGACCACGTTAGCTGCTGTATCTTCCACTGTAACATTGAAAATGTAGAGATCTTGAGTTTCGTAATCTA
ACTCGCCGGATACAGAGATTTGCCCCGTGTTGTAATCCATTAAGAACGGCACAGGGTTATCTGGGTCGTCTACAATTGAAAAGTGCAGAATATCCCCCGC
ATCCGAGTCTCTAGCCTCAATTGGTACACCCACCAGAGCATAAAGGGGGGAGTTTTCTTCAATTTCTCTCTTGATCACGTCTGCGACGATAGGTGGTTCG
TTGACATTTAGCACATGGATCGTAATGGTGCACATCGATGATAACGAGGACACAGTCGTTGTACCCGTCGATTCATTTCTGGAAATAAAGTTGTCACCAA
TTTTGACATGGACGGTGTAAAGGTTCTCTGTCTCGTAATCAAGAGTTTCCGAAGGTCGCAACGCAAACCAATACTGATTGTCGTCCTGTTGAATTGCAAA
CATATCAAAGCCAATCTCACTTGGATCACTGATCACCTCAAATAATGTGATAGTGTTTTTGCTGGGCGAATCCGGATCACTCCACTCAATTGGGCCAAAC
TGATCATCTTGCGTAGCATTTTCAAACATGGATAGAGCCCCATCTCGGCATTCTGGTTCCTCATCGACGTCGGTGACTTGTACAATCACAGGGCCTGCAA
CCGCCTCCAGGCCCGCTCGATCAGTTGCACTGACGGTCAATACGTAATAATCATTTGTCTCGAAATCGAGAGCATTGGCCTTGCTTATACGTACTTCTCC
ATCACATGAGTGAATCATGAAGATATCCACGGATTTACCATTGAtgtctgttgctgcaacaaggTGGTAGGAAACCACATCATATTCGTCGGGATCATAA
GCAGGTCCAATCACCCCTACAACCGCTCCTCTGGATGCATCTTCAGGAATACTCATTGTTGGTTGAGGCGTAAATTCTGGCGGCTCGTTCACGTCAACAA
TCATTACACGTATTACTGAGGATGTCTGGAGCCCTGGAGCATCAACAGCAGTAACTAAAAGATCATAATACGACTTCGATTCATAGTCAACCGGTTCCAC
CAGCGATACCAATCCTTTGTCTGTAACCAAGAAGCATTCCGATGAGTTTTGCGAGAGCGTTACCGAGTCATTTTCCGGGTCCCAAAACGATACACGAGCG
TGACTATCGTCGTCCCCGCGCACCCAATCTAGATTTCCACCTACCGACTCCGGTACCCAGAAATTACCTGGAACGATTACAGGAGGTTCATTCACGTTTT
CTACTAACAGTTGAACGTTGGCAGAGCATACTAACCCACCGCCATCCACTGCTTCCACAATGAACGAAACCAAGCGCTGGGCCTCATAATCCAACGGACT
TTTTAGCGTGACTTCTCCAATATTTGAGACAATCACAGCGTCACCAGTCGTAACACCGTCGATCATGTAGTAGCTGAGCGCACCCCAAGTCATCGATGTG
TTCGCATCTGGGTCAATCGCCACAACCGAGCCAACCAACCCAACTACATTTTCAGGTGCTTCCATCGTAATTGTAGCATTCGTGAAAGCACACGCTTCAT
TCTCGTTCAACACGTTAAGTGTCAGATATCCAGTAGTTTGTTTAATCGGGCTCCCATCATCGCTAATTGTGATAGCAATTGTCACCTGGCGGATCATCTC
GTAGTCAAACACGCTTTCGTTCAGGACTTGAATTGCGCCTGAATTCAATCCGACAGAAACTACATCATTGTTTGCACTCGTGGTCGTCGAATTGTCCGGC
AAAACTAGAGCTGTTTCTCCCAATGTAAAgaaatgctgctggttgtagTCTTCATCCGTAAATTGAACAACCCCAACCAGGGCACCGTGTACCGGATTTT
CCGTAATTGAAAATGACGTGGAAGAAATAATCGGAGGGTCGTTTCGATCCAGAATTACAATTTCCAccgtcgctgttgctgacAAATTGCCAGTATCTGT
AGCCGTAATGGAGACTGGGTAGAATGATTTCACTTCAAAATCTAATAACTGCGTTGTCGAGACAATCCCAGTGACAGAGTCAATAGTAAACGTTCCAGTA
TTGTCAACTAGAGCAAACGTCAAGGTGTCGTTAGCGTCAAGATCCGTTGCAAATAAGTTCCCCATGAACGATTGATTGAGCGCTGGAGATGTGCTTACTG
CAGTCCCAATCACTGCATCTTCTGGAATATAAATCGTTTGGGGATAGACTTGCGGGGCCTCGTTCACGTTTAGGACTTGCACAGAAATCGTAGTAAACGC
ACTCAATCCACCCGGACCACTGTCGGTTGCCGATACTTGTAAAGTGTACGATTGCTGTCGCTCAAAGTCCAGCGCCGGTCGATAGCTCACCACTAATCTG
CCATCCCCAGCAATTGATAGAATTCCAAAAGTACCTAAATCATTCCCGTTGATGATGCTGTAGGTTATCGTCTTGTTTTGATACGTGTCGCTGTCAATTG
CAGTTACAATGCCAACAACCGTTTGCACCGCTGAATTTTCCACGATGCTAAAATTGTAAAGATGTGCTTGAAAACCCGGGGGTTCGTTGCTATCGGTAAC
ACTGATTACGACATTTGCATCGGCATAAGCTCCTTGCTGATCCAGTGCACGCACTGATAGCTGGTATGACTGTTTTGTTTCAAAATCTAATATGCTTTGA
AGTGAAATAACGCCCGATGCAGAAACCGCAAACGTACCCTCACTCCCAAGTTCTGCCGTCAGTAATTGAAATGATATAACGGCACCAGCATCCACATCGG
AAGCTACCAAAATTCCAACGACGCTTCCTTTGGTAGTGgcttcagcaacaccaaaCTGGAACAACTGCTGTGAAAACGTCGGAGGCTCGTTAACATCGGT
CACGGTTACAATTGCAGCTATGGTATCAATCAGAGAAGTCGATGATGTGTTCTCTTTGTAAATACTCGCAACTGGAAGCGTGGCATAGATCACACACATC
GGCGTTGTCTCAAAATCTaatcctccagcaccgagaCTTATCTGTCCACACAAGTCCAAAGAAAAATTTGCACGACGACCGCATGTACTGTTCGCGATAA
CCATCTTCTCTGAGCATCCTATGAGTGCATTCAAGTTCTCTTCGTCAATAATGTACTGTGAAAGCGGGGACCCTATAACGCCACCAACAGAAAGAGATTC
CGCTACCGTGAATTGGACAATATCCTGCACAAAGTACGGCGGCTCAAACACATTCAGAAGATCGACCTCGTACCGGGCGTTTGCTGTCAAGTTGCCTTTA
TCTTGAACACACACAACGACCCAAAGTGAATCGACCCGTTCGTAATCTAGCACCGTTGAATTATAAACGACAATCTCAGCGTTGTTCTGTCCAGTCATTT
CAACGCGAAAAGCGTTCGAATTACTTTGCTCGCAGATCCAGAATTGATGGTGCTCATTTATATCAGGATCTTGGACTGTGATCAGCGTCACTATCGTTTC
ATCGGGTGAGTTTTCTTTCAGAAGTGCAGGAACGGAGCTTACCAGTACCGGCGGTTCGTTTACATCGGTAACGTAAATTGTACCTTTCGTTGATACAATA
AACTCTCCATCTGAGACTTCCACGATGACTGGTAATGTGTTTCCTGCTGGGGACTCGTAGTCTAGTACACAATCGACCCGTAGGAGCAGCTGCCCAGTAA
ACGAATTAATTCTGATGCAAGCCACGACATTGTCACTCGTGCCGCCGAGATCATATTCAAGTACGGAGCCTGCGTCTGGGTCAACCGCAACAATAGGATC
TCCAATTACCGATCCTGGCATCAAATTTTCAGGAACAGAAATGTTAAATGTTGAAATAACTGGCGGCTCATTGACATTGATGATCATCACAACGAAGACC
GCTTCATCAAACAAACCGCCGTAGTCCGTAACGCGCACGCTTAAATTGTATTCGGCTTTCGTTTCGTAGTCCAGTTGCGCTGAAGTTGTCACTTGGCCCG
ACTTCGAGTCAATAGCAAACGTAGATAAGACGTTATTTGCCAGTGAAAACGTTAGCACCTCATTTCCATTCGTGAGGTCTGGATCTGATGCTATTTCTTC
GAACGCTTGTCCCAATTGAGTGCCAATACTGGCATCTTCACGAACGCTGAACACTTGGCCTTGGATGATAGGTGCCTCGTTAACATTAATGATTGACACA
GTAATGTTGGCGATTGAGAATAGCCCAGTATTGTCTCGTGCCTTAATCAGCAAAATGTATGCGTTTGTCGCTTCGTAGTCCAGTAGATCTGCCTGCTGGA
ATAATATTCCAGTCATTGCATCAACTCCAAATGCAGTTGGagctcgtgttgctgcattaATTGGCGTTTCTGAAATTATACTAAAGGATATGCTATCCCC
ATCAGGATCTTTACCTTTAATAGCAGGTAGAAGTTTCGTCATGGCAGGCTGGTTCTCCATAATTGAGAGTTGCATAGCGTCGATAATAGGTGGTTCATCG
ACATCGTTCACCACAATATTGATATTTTGGATGCTGCTTTGTGCTCCAGATTCATCCGTAGCAACTATAGAAATCACGTACAAAGATTTCGTCTCAAAGT
CAAGTCCATCGCGAGTTACTTGGACTTTGTTGTCGACAACATCAAACATGTCGATCTGGCCAACCACACTGACCGTGACTGTATCTGGGTGACCATAGCT
GCTAATATCAGGGTCAAATACCGTAAGATTTCCCGTAGCCTGTGTACCAGCGGGTGAATTCTCGTCGATGGAAAACGAACTTGCAACCATCTCAGGGTTT
TCATTGATGTCGTCAATAACAATCTCGACGCGTTGAGGAGGGCTTGACAGACCACCCAAATCCGTGGACTGTACCAGTAATGACCATGTTTTCTGTTCTT
CATAATTGACACTTCCAGGATCATTTACAACGATCTGACCTTGGGAAGTAATGTTAAACGGACAGCCGACCTCAGCCTCCACAATCTGCCAACCGTGAGT
ACTCCAAGAGCTATTTGTCACTCCATTATTATCTTCATCAAGAACCGCAAGCGTACACACAGTCGCACCAACAAACTGACTCCGTTGCAGTACGTCCAAG
TCGTAGGGGATTTCGTTCATCTCACATGTCTGAGGGAAAATAGTTGTTGGTGCATCATTCGCATCAGAAATATACACTGTCACGGACCCACATCCGTTCA
GAGGCGGATTTCCCCCGTCTCTAGCGCAGACAGTTTCCACGAACTGCTGTTGAACTTCATAGTTGAGAGCAGTTGAATTTGCTACTAACAATGTCCCTGA
AATCGGGTCAATCTGGAACGCGGTATCCTGGGTATTTGCCAAGTAGTAAGTCACTTTGCCAGATGCCAATTCCGGACTGTCTGGATCAAAAGCACGAACA
ACACAAATTGAAGTTCCAGCGAGTGGGTTTTCAGTGACATAGCagctcttctcgttcacaaCAGGTGCCTCATTGACGTCAATGATAGCAACACTGACAA
TTGACACGGCGGCCAATCCCATCCTATCTGTGACAGATATCCCAAGTTCATAGCTGTTTTTCGTTTCGTAATCCAGTAGATCCACATTCGCTGTTATCTC
GCCACTGCTTTTGTCCACAAAAAACACGGGGTGATGCGGATTGCCTTGTATGATAGCAAACTGGGCAGTGTCCAAGGCATCAGGATCTGTGTATGGTACC
ATACCACCAACCAATGATACTCGTGAAACTATACACGCACCACAAAAACAACGCAAAGCAATCATTATTTTTTTACCGTTCTTGTTAGTTATTGGAACAC
ATCGACGAGTCACTATAGATGGTAACTTACCTTGAGCTAACGCGACTTCAAGAACAGCGGCAGTTGTAGCACCACGATCGAAAGCGCTTACCTCTCCAAT
CCCACCACCCGTGATGAGGAAGGCCACAGTATTAGACCTCACAATACCAGACAGTACAGTCTCGAGAATTGATGCAATGTTTGAGGACCATATCGTGGTA
GCGGTCACTTCTGTTTCCATTGTCCACTGCACAAATGCCGGCATTCCGAAGTTTTCCAAGCTTTGATTCATACTCCACGAAATATTGGAAGTGTTTATCA
CACGTATTTGCAAAGAGAAGGGGCCGATCTTCCCCGACGGAACTGTAAAGCGCAACTGTACCATCGAAAGATGATCAAACACATCTGGCAGTTGGACCCC
TTGAAATTGAAGAACAAGTCCAACCGATCTCTGGCTGAAGGAGTCGTACCCCACTGGAAgagttcttcttgatgcgTTTATCAGATAGCCTCCAGCATCC
TTCTTAGTGACAGTATAGTCAGCTTGATATGAAAGGATGGGGAAAGCAAACATCTCATTCGGTAGTACTCGTGTTGGATCCGAATTGGTACCTGTGGAta
gcaagaagaacgtccAAATATGAGCAATGTGCACCTGAGTAATAATTGCACTGGTTGCATACCTTCTTCAACGCTGAGGGAAATATTCGTCGTCTTGGGG
CTCTCGTTAACATCGCTGGCTGCAATAAACACCACACAGCTGGTACTAAGTGTACTGAGACCGTTGTGATAGGCACCATCATCGGCAACTACGATACTTG
CAGTTGTCGAATTAAGAACTGCAGACTCGAAGTCGAGGTTAGTCGCGCAAGTCACGAATAGTTGGCCGGAAGTCGGATTTATAGCAAGGAATTGGTGTTG
CAGCGAAAAAGTAAAAGCGGTTCCAATATCTGCATCCGTCACACTCGAATTCAAGGGTAAGCCGACTTGAGTTCCAATCGGAGAATTTTCAGCCATATAG
AAGGAGAGACTCGTTTGGCAGACTGGCGGCGCGTTGTTGGCAaccacatcaacaacaatAGTCGCTGTGGCTGAAAGTTGCTGTAGATCGGCCACCTGAG
CTGTTAGCATAAAACTGTAACCAGTTTGTAGTTGTTGAATGCTTTGTGACGAGGCCACTAACAGTTCACCAGTCTGTTGGTTGACCGAAAACACACTAAC
CCCATCTTGTGTGCCTGGTGTCAGTATATTCGCAGACGACAGGAACGAGAATGACAAAACGTCGCCGTAATCAGGATCGATGGCCTGGAGTACACCGATC
GAAGTGCCAACAACGGCGTGGCCAGCCACAGTAAAGGCGAGACTTGTGTTGGTAGCTGGAAGAAAAGAAGGTGGTTCATTGCAGTCCTCGACAGCAATTC
TAAGGAGTGTCGATGTGCACAAGACATACGGGTCGCAAGCTAGCAGTACAATCGCATACTGCGTTATTGCTTCGTAGTTCAATGTAGTCTCCAAGTTTAC
ATCTGGAGCGCCCGAATCGCGAAAACTGATAACGCCAGGATATGCAGAATCCGTCACTTGGTATGTCAATTGCTGGCCTACGTCCTCGTCCTGAACGCTC
CATGTGAGAACCACAGCTCCAATAGTTGCGTTTTCAGGAACCGATATATCAATTATCGGTTCGCTAGTGGGTGCCTCATTAATATCGAGAATTTTTATAA
CCAAATGCCCATGCGAAGATAATGGTGGAGCACCTCTGTCTGTCACACGAATGTTCACATACGCTTGGTGAAGCACTACCGTTTCGAAGTCAAGGCGGTG
TGATCCCGCAACCTTGACTTGCCCACTCCCGCTATCCAAAGAAATCATTCCAGGTAGAGATTGATCAATAATTTCATACTGCAGAGTACTTGTTTGGTTG
ATGTCGGGGTCATAAGCTTGGAATGTGTAAAATGACGTGTTGGTACCTTCTGCCACTTGCACTTCCTGGTCGGCTACTACTGGTGCCTCGTTCACGTCGG
TGACGTATACGATGAGATTGCATGCACTATACGCGCCACCTGAGTCGCACACAGAATACTGGAAGTTATATACTTCTCGTGTCTCGTAGTCGAGAGATAC
GCCTTGCACAACAATTGACGCATTATTAAATCGAAACCCACCAACGCCTTCGCTATCGATGAGACTATAGTTTGGACGTAGTCCCAGGTCACTtgcatca
acatcaacactTTCAAACTGAGGTGCGATAACAGTTCCCGGTGGACTATTTTCTGCAACGTATCGCGTTTGAGACTGGCATGACGGCGGCTCGTTGACAT
CAAGCACATCAATACCCACTGCCATGCAAGTTGCCAAAAGACTATCGGTCGCACAAACTTGTACAGTGTATGAAGCTCGCGTTTCATAATCCAACACAGC
AGTGAGTGACACGCTTATTTTTCCTGCTATTGAATCAATCTGAAAAGCGCTTTTGTCGGTTAATGGCTGGATGAAAAACGTCACAGTGTTATTCCTGTCA
GGGTCCGAAGCTGTAATCGAGCCTACAACCGTTCCAGATGCTGAATTTTCGTCGATAGCTAATTCGTACTGAGTTTGATCAAATACTGGCGGCTCATTTA
CATCAAGCACAGTAATTGACACGGGAAAGCGTAGCGGGGCTTTGCTGGTATCATAAACCGATACGCTTAAGTTTAATTTTTCCGGCATTGTTTCGTAATC
CAGAGGTAATTTTGAGCGGAGTTGGCCTGTGCAACCTTCCATAGTGAAAAACGGTGAATACTCCGATACATCCAACGTGTAGCTTAGCGAATTATTCTCC
GGATCCCACACAAAAAAAGACAGTGCTGCGCCAATAGGCAAACCTTCTACCATATTTTCTGGGGCTACAGCTTCCACAGTTGTCCCAGAAATGAGTTCGG
GTGGTTCGTTTACATCTGTAATTTCAATAGAAATAGTCGAGTTAGTGGTCAATGATGTCCCATCCTTAGCGACATTAACAGTCAGGTTTACGGAGCGAAC
GAACTCATAATCGAAAGGTTCGATGAGGATAAGTTCGCCAGATATCCCGTCGACTGCAAATTGTGAAGTGTCGTCCAGTAGCGCAAATCTTAATTTCTCG
TTGGAGATTCTATCGGGGTCAGTCGCATTGACAAGAAGGATATATCGTGGAACCGCTCCATTCTCCGGTACCGACAAACTGTACCAATCAGGCACGCGAG
GggcctcttcttcgtttAAAACAGATACAAACAACGTAGCCTCTGCTGTCAAAAAGCCACCATCCGTCGCTTGGACCAGAAGAGTATACTCAGAATTGCT
TTCATAATCTAGTACCCCAGGTGTGAGTAGCGAAACAACTCCTGTACCAGGATCCACAGCAAAAATACTGGTATTCAGCATGCGAAATCGAAGCGATGAC
CAAATCGGATTGGTATCCGGATCCGTTGCTTGGATTGTCATAACCATTTGCCCCTTAGCTGCAGTTTCGCTAATGTGGCCACGCTGTCTCGTCGAAATTG
CAGGCACCTCGTTCACATCAGTGAGTTCAATAAATACAGTGACGTATATCGACCTTGGCAGTGGCGCATCATCAGTAATTTGTACAGCGCAGTGAATTAC
TGGGTTCGTCTCGAAATCAAAGACTACAGGGTTTTGTACAGTCAATTTGTTCGAAACTTTGTCGATCGTGAACGGGCAATCATAACTTAAAATCAGAGCG
CGCAGCTTTTCAGTCGTTTCGACCGACTCCAGCATTAATTTGCCAATCAGTGCATTTTGGCTCGGATTTTCGTCCATCTTATAAGTTGGTAATTCTACCG
TGGGCGCATCGTTTGCGTTTATAATCGCGATGGTTGCCAGGACACTGTCATTCAGACCGAAATTGTCGTAAACTTCAGCGGTAAATCtcagcaattgctg
cattTCAAAGTCAATCCAACGTCGGCGCACAGAAAGATATCCGGACTGAGCGTTAATCTGAACGCCTGGTGGTCGGTCAGACTCACGCAGATGAAatcga
agttgctgttgctggcctACGTCCTGATCGGTTGCTGTCAGTGGACCTTGTAGCTGAAAATCTGCACGATAATAAGTAATTAGCATTTAATGGAGACTTA
TAGCCTACAAAGAGAATGCAATGCGTACCTGAGTCGGGTCCATACAGCTCAAGCCGCAGGCATGTACTCCCAATCCATCCTGTCGGTATAATTCGTATCT
CCTTGGCGGCAACACTGGGGATGACTACACTAGTCTGACTTGAGGTGCCATTGCTAGGATCCAAAGCGGCAAAATCGATCGGTGTATCTGAGTTTTGAAG
CACAGTTGTAAAATCAGCAGTTCTGGAGTGCCGCCACGCTACTCGAAACGTTTTCAGATATCCAACGTTGCCATTCATATCGATGCCGGGATACACCTCA
ACTCGAGATATTATCGTCGGTTCGGGGAAACTTATTTGAACCCACTCTGTAGTCGACGCGGACGCTGGACACCAAGCACCATTCTCGTTGTCACTTCGGA
TAGCATTAAGCCCTCCATAACCATAGCCGTGCGTCTGACTGTTGTTTAGAAAACTGCTAGCTGTGATCGCGTCTGGCTTAAGTATCGGTCGGGTGGACTC
ACCGATAAGTTTGCTGTCAGAATCTAAAGCAAAACAACACAAGCATTAGCGTTAAAATTCTAGCACAGAATTCATGGGCCTTTTTCATGGAAAGCAAACT
TACATTGGGAGCAACAGGCCAGTTGGGTGTTGCCTGCATTTTGCTCTACGCTTGTAGCGCTGTTGGTACAACCAGTTGCCAACATGCCACCCTGGCTTGC
TGAAGGAAATGTAACGGGGCTATACTGCGGATCAACACACAATGACTCAAAATCCATCACATCGCAGAGACGTAATCCTTGGTTGCTGCAGTATTGGGTT
CCCTCATCTTGGGTTATAGGACCAGCACCTGATTGTGCTATCAAAAAGAAGCTTGGAACTTCAAGTAACGTATAAAACAAATTAGACAGAAAACTCTACA
TCAATGAACAGAATTCGCACCAGAATATGAAGTGAGTTCTTGTACTTGGGAAAACGAAATTGCGCCGGCAAAAAAATGAAAGCGAGATATCCACCCCCTA
AACAAAGCATTAGGTGCCGAAAGGACAGCTTGTTGTACGATGTATGGTGGTTCAAAGAACACCACCGACGACATGTCGAGATTGCCGTCTACAAATACGC
GAAGTGTCTGATCGCTGATTGTGTAAACGGTCGCTACGTAATGCCACTGGTTGTCAGAAATAACGCTTCTGCCTTGGACCACCGAGGAATTGGTTGAAAT
GTTTAGCTCTCCGCCACTCCCCACAGAAATATCAAAATAATCGCCCGTAGGCCCAAGCAGCAGTAAAATATTCCTTCCCGTCAAGTTAGTGCGCACACTC
ATCGCAGTGCTGAAGTCTAGGTCGCCAAACACGAAGTCAAAGCTGGTATCACGTTGAAGATCGTGGGAAATGTTACCGAAAAACATCCCACCACTAGCCA
TAAAGTGAAGATTTCcatcatcgccttcgtcaAGTTGAGCAGCCTCGGTAACCGTGCGTACGTTTTGAGCAGAAACATCAAATTTGGGAggctcgtcgac
gtcgataACATTTAGAGTGAGTTGTGCGCAACCCTTCATCACTGCAACGTAATCGTTTCGTGCTCCGTCATCCATTGCGCACAGCACGAAGGTAACCACA
GGTTCCGTTACAAAGTTTAGAGCTGGGGGCCACACGTACACATCAGCAGCGCTTTTGCTTACAGCATGGAATCGAAATCTATCCGTTTCTGGAACGGTGT
AGAAGGACAACACACTTCCGTTGTAGGAGTCAACACCACAGACCTGGCCAATTTTTGTGCCCATTTCTACATCCTCATCAACTTGAAATACAAAGTCTTG
AACAACCGGTGGCGAATTCACGCTAATCACCAAAATTTCTAGAAGTTGGTTTGTTGTTGATGGTAGTCCAGTTCCAAATGTATCGACCGCCTCAACCGAA
ATATTGAATGCTTCCAACGCGATCAATTGACGTGATGCTGTTAGCACTCCTAAATTACTTAAGCCAAACGCTTTGTTCGCGCCGTCAC