Description :
From Genome Similarity Track
Location :
Scaffold_1129:1297- 2566
Sequence
1269 bases(100 bases per row)
CATGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCC
ACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTT
CCAGCTTTACCGCATGTTATCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCAATCCAA
ATAAAGCCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTC
ACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTAATACTGGAATAGCCGCTTC
TAGGGTGGATTTGGGATCCCACCCATGTAATAAGTAAAATGAGGTATCACCTCGGATCCTGTCTTGGGCGGTAATCATCGCGAAGGGGAGTCGTTCTGCG
TACTCATCCCAGTCCCTCTGAGTCAGATCCTGGACATACATCTTGAGTGCCCTCGTGATTGTCTGCACCATGCGTTCGGCCGATCCGTTAGCTTGGGGAC
GATATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAGGCTCAAAAGAAGTCGGACATAAAGCCTGGCTCCCGATCATGCCGAATCATCTC
ACTAACTCCAAATCTTCGAAACCGCACTCCTCGTATGATTCAGCAATGGTTTGTGCAGTTCTAGACGTACTAGCTTTGGCTATCACGTATCCGGTAAACA
GATCCACCCAGAACAACAATTATGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGAC
ATTCCCAGGGTGACTCTCCTTCGATCGTAGGTCTGCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTC
CAATGGAAACATTCCCGGATCCGTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAAGT
TTCTGGCATCACCAATCTCATCAATCCATCCCGGTCCCCGTGGACTCTCTTCGTAGGGGGACAATAGAA