Description :
From Genome Similarity Track
Location :
contig_48:129671- 133722
Transcript NameFunction/comments
g8368.t1hypothetical protein

Sequence
4051 bases(100 bases per row)
CCTTACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCTTCATCTGGATCACCGGCGTGGTTGTCGATTAGCATGTCGCGTGAAATCTTAATGTAGGC
ATTTCCCAGATCATTGTGTACCTCATGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCAGCAGCACTATCGGAGGTGGCAGCC
GTGCGAACATGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTTTCTGTAGCCGAGCCGC
CCTTCACCACCGGGAGAATTTGCCTGAAATCTCACGAAAGGAGAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCT
GTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAGCTTGCTTTCTTCGTCAATTCCGTGACCTGAGATCGCTTGTTG
ATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGTAGAGAAGCAATCCCACTGGAAG
CGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTTGCCAGTATGTTCCGAAGCAGTGTCGACTGCCCGGTACCGCCTGGTCCATCAACGAAGAATAG
CTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCA
AGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGAT
CAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTC
TCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAG
AGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGT
CTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTC
CAATCACACGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGG
GTATATCCTGGTACAGCATTGTCTCCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATTGTGTGATTCCCACGACC
AAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATC
AAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCAC
CCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGAC
GTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCCTTCCATACCAGG
ACGCCTTCAGCTCATCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCC
CGTCCTTCATGCAAGCGCATGATGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACATTTCTCTGTC
AGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTT
TTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGC
TACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAATGGCCTCGACTATTCTTCCCATGTAGGGCTGCAGTTCGTTGTCATGAACACATCAG
GCTTGCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCC
ACTTGTTTGAGAAAATGGGTATCTACATCACGGCCTCGATCAGGGTGGACCAACGTACATCGCCTCTGTCAAACTCAGAGAGTAGCCCTTCGCCTGCTTC
CAGCTGAATTGTTCCTTCGTTCAGCAGTGCATCCTGAAGCTCTCGGTACTGATCGGCGTGAATTTCATTCTGATGTGAGGCCACCCAGCGAAGTTGCTCC
TGCTCGCACTTAGCGCGTTGGTCGACACACCACTGTGAAAGAGACGACCACCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGC
GACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCGTTCGCGTATGTGTCTGTGTAGGTACAACCCAGCTCCCCATACGGAAGCAGAA
GAGGGTACTGGAGAAGATCATACTCCGGCGCGTCTCGAACAGTCGCAGAAGCCTGTTGATCCCGAGTATACAGTAGTAGGTCGCGATGCCTATCCAGGTT
GCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTGGCAAATTGTATGCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGAC
GTCGCTCGTGTTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGTTGAGCGAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCA
CAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACATATAGATCTGCGCGAACTTAGGGTCTGTGCGCTCT
CCGGTGGCGGGATCGATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTG
CATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGC
TGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCTCCAGGC
CACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCTC
ATGGTTTGCAGACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGT
TCCGCATGTTGCTCTTGGTTTACCATGCGTTCTTCGGCGTTCCTCCTGCGTAAGTTGTGATCTGCGCTCCGCGTGTTGCTCTTCGTTTACCCTTCGCGCT
TCAGCATGCTCCTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGTTCTTGGTTTACCATCCGTCTTCGGCACGCTCCTCCTGCGTGAGCTGTGATCT
GCGCTGGGCATGTTGCTCTTGGTTTACCATCCGTTCTTCAGCGCGCTCCTC