Description :
From Genome Similarity Track
Location :
Scaffold_322:1296385- 1298219
Transcript NameFunction/comments
Aphin_H310_00375myosin-like protein

Sequence
1834 bases(100 bases per row)
ACACATACACGGGCAAGATCTGCATTGCTGTGAACCCGTACCAATGGCTCAGTCTGTACAGCCCCGACACGATGCAGATGTACATGGACGGTTCCAGAGA
AAACAAGGCGCCTCACGTGTACGCTGTCTCGATGGAGTCGTTTTTTCACATGCGGACGCACACAATTAACCAGTCGATTCTCGTGAGCGGCGAGTCGGGC
GCCGGCAAGACCGAGACGACCAAAATCATGATGAACCACGTCGCAACGTTGTCTTCTTCCACGGAAGGTTCAGATGCGGCGCAATCGTCCATCATCCACC
GCATCATCCAATCGAATCCGCTACTCGAATCATTTGGGAACGCCGCCACGACGCGCAACGACAACTCGTCTCGCTTTGGCAAGTTCACGGAGCTACAGTT
CAACCCTCGAGGCCACCTCATGGGCGCACGTGCGCACACGTACCTGCTCGAGAAGAGTCGCGTGTGCCACCAAGCTCCAGGCGAGCGAACGTTTCACATT
TTCTACCAAGTGCTCGCCGAAGCCGCAGCATTACCGCAATTGCACCTTAAGTCGTCGCATCAATACCGCTACGTCCAACAGGACAAACTGATCGAGTTGG
AACACACGTGGAGCGACACGAAGGAGGGACTGACAATCGTTGGCATTGCCGACTCGATGCAACTCGACTTGTTGCGGGTGCTCGCTGCCATCTTACATTT
GGGCGAGTCAGATTTCGAGATGGTCCAAGGAGACGTCGACTCCTCCCAGGTCAAAGACAAGACTGCGCTGACGACCGCTGCAGACCTTTTGGGCCTTCCG
TTCACCAATTTGGAGAAGGTACTCACGTTCCGCAGCGTCATCGTTGGTCGCGAAGTTATTTCGAAACCCATGACAGTCGACCAAGCCCGCGACTGCCGCG
ACGCTGTCGCCAAATCCCTATACTCGTCCATGTTTACGTGGCTCGTGGACCAAATCAACGCCGCGATTGGGGTCTCCCACTTCTCGCACTTCATCGGGAT
CCTCGACATCTTTGGGTTTGAAGCTTTCGAGCACAACTCGTTCGAGCAGCTATGTATCAATTACGCCAACGAAAAACTCCAGCAAAAGTTTGTGCAAGAC
GTGCTTAAGACGGTTCAGGCCGAGTACGAAGAGGAGGGAATTTCGTGGCACCATGTCAACTTTGCCGATAACCAGGACGTGTTGGACCTGATTGAAGGTC
GTCTCGGCGTGCTCAGTCTGCTCAATGAAGAGAGCAGTCTCGCCACCGGTACGGACGCATCCTTCGCCCACAAGTTGTCAGCGGTCATGGCCAACCACGC
GCGCTTCGAAACTCCACGCCTGCACTCGTCCGCGTTTATCATTTTGCACTACGCGGGCAAAGTGCTGTATGACACGAACGGTTTTCTCGACAAGCATCGT
GATGCCCTTTTGCCCGACATCAAGAAAGTCCTTGGGGAAAGTTCAGTGGATCTCGTACGGACCATGTTCCCCACCGAGACGACCCATCGATCGCTCCATC
GCCAGTCGTCATCGTTGACTGCGAATCACCACTCGAAGCACCGGCCAGGAGTTGCCGCGACTCGTGCTGTCACAGTTGGCAGTCAATTTAAGGAATCTCT
CGCCCGCCTCATGGACAAAATTTCCCACACGAACGTGCATTACGTGCGCTGTATCAAACCCAATTCGGTCAAGTCGGTAAGAGCTATTTCGTTGAACGAG
ATGGTTGGATTTTTATGTGCTATTGCCATAGCCGAATGTGTTTCATCATGAGTCGATCGTGGACCAGCTTCGATGCGCGGGTGTAATCGAAGCCATTCGC
GTCAGTCGATCAGCGTACCCGAGCCGTCTACCCC