Description :
From Genome Similarity Track
Location :
Scaffold_102:129604- 137498
Transcript NameFunction/comments
Physo_141700hypothetical protein
Physo_141701hypothetical protein
Physo_141702hypothetical protein

Sequence
7894 bases(100 bases per row)
CTGCGGTCCACCTTCGACTTGTACGGATTACCAATGTAGATCTCAGGCTTACGACGACAAGCCGCCGCTCCAAGATCCTCCTCGCTCGTTTCCGCAAGTA
GCTTCAACAACTCAACTATCTCGCCGTAGAATCGGGGAGTTGCCTGCAGAGTGCGCTCGTGGCCACTCACTCGGATCTGAACAGCAAGGTCGTTCTTGAG
AAACTCTTGGTCTTTCGAGATACGCAGGTACTCGAAAATACCCTTGCCAGTCAGACGAGCAGGCGCCAACTCAAGCGACCGTAGCGACTTCATCGTTGCC
AGGGAGATCAAGGTGCGATCAGTTAGCGTATCGATGGACTTGACGCTGTAGTTGGCATAGCCCGAGCAATCCGACATCGTAATTGTCTCCAAATGTGGAC
AGCGATCCGCCACTGCCCCCCAGAACTCGTCCCCGTACAACCTCGTGTTCACGTAGCGAGACCTGGCATTACGTCGATAATCGATCGCAATCGATAGCTT
TGTCAGCGTGGGACATGCTCTCAGCACCGCAGTGATCTCCGAGACCAGCAAGCCGTAACCAGGGCGACTGGCCTCAACGTCTTCCTCGTCGTCGTTCGGA
GGTGGAGCCACGATCTGGCCATCGCACTCACGGAAGTAGCGATGGTAGTTCCAACACTCGTTGGCAGACAGCGACAACTCCATCAAATTCGGCTTCACGT
GGTCTCCGAACACTTGAAAGAACGGATCGGCAAAAGGAACAACCGCCCAGCTAAACTTCTTCAAACTCGTGCACGTCTTGTTGAACTTTTCCCACGTATC
CAACGTGACCGCCCACATGTCGTAGCACTGGGCGTCCCCGTGCACCTTCATCTTCTCGTAGCCATCCAAGAACTCTATCTGCGGACAAAACTTCATCACG
GCTTCGAGAAACTCCGTCGTGCTGCGAAGCCGCTCCACTTCGTTCCTTGTCGGCACCGTGAGCTGTCGTAGTCCAGCCCCAGTCTTTTCGTCGTGCCACC
TCTCCAGCGCTTGATACAAAGTCGTCGTCAACTTCTCGATTGGAGCTCCATACACGGCGTTCGTGTACTCGTAGTGGTTTTGTAGACAAACCCTCTGCTA
GGTAGAACCAGCGCCTCCAAAGAGCAACAATACTTCGACGCCACCTCTAGAATCTCCAGCACGTGTCTACTCACCAACGACAACTTGGTCAGATCGAGTC
TCTTCAAAGTGGGCAAGTGTCTAAATACTCTGTCCCAGTCGATATCCGAGTCGTCCAGAACGCCCGGTGTTGGGTCGTAGCCGCTCTCTTTCCTCCCCAA
GCGCACCGTCAGACAGCGTACAGCAGCTCCCTTGCTCTCCGCCAATTGATACATCCGTGGGATATCCTCCGCTGTCATGGAAGCATCCGAGCCTAAAGTC
AGCGAAAAAGCGCTGCATTACTCAGCCAAAACTTTGACAGTTTGTAGCGATTGCTTGGACACGGATGCAATGCATTGCAGATGGTAGGGCGACAGGTAGG
GCGCGTGGGGTACTACCACTTCGGTGGCGAACCCGTTGACTGCGAACTCGAGGATGTGGGAGAGCACAGGAAGCGGGAGGGAGAACAGCGACGGCACCAT
CGTGGATGCCGATGCCTCAACTCGAGGAATCTTGAGTGGCATGAGCAACGGGTTGCTGGTGGCGCAGGTAGAAGGCGGGTAGTCCAGCGTGCGACCTTGA
AGTGCGAGGTTGAGTGGTGCTAAATGCGTATTTCTACGAGTTTAGAAACATTTCTGTAGAGGCGGTCTGTACATTCTACGTTCAGTTAGTGTAATATTAC
AAATTCAAGTAAAGAGATACGCTTTCGTTTCCTGGTTTCTCTGTGAATCATAAAGAAGCAAAGAGACTTCAGAGACGCATCTCCACAGTCGTTGATCTCT
TCTTCATTTGTTTTTAGGTCGGGGCGCATCAAGGCCCACAAAATGTGGTGGTGCAGTGCAACATTTGCGCGCATTTGTACTGCAAATGCCCTCCATAAGG
AATAGCGCAACGCGTTTCGCCTATCTCCAGCGAACTGTACGGCATCGATTCCATACATTCTCCTTGAGTAGGCAAAAGTTTTGCCGCAAAACAAAGCCAG
GGGCTCCAATCGTGTGCACAGCACCTGGTGAAAACATGTACCGCGATTCGCGGTACACATCACGGATAGTACACATCACGGACGCGGTCCGCGATGCGTT
CGCGATCACTGTCGCCGTCGGCGATTCGCCGATCAACAAGACGCAACAAATAGAGTTGTATTTTAGAGGGAAAAAAGTGATATTAACGTTAATATCAGTT
AATCACAAAATTGCGCGCAGTTATTAATAATTAAAAGGCAAGATTTAGCTGAACCCATTTGAGGCAGCTATTCTGTATTTACAGCCATGTACTCAATTCT
CAAAGGAGGACTCTATCAGGCCGACGAAGTACTCCGCGCAAGCGTAAGCCCCGCGAGGACCTGATGCAGAACCAGCGCCCCAAGGGCTATCGTCTTCGGT
GCAGACGTACGTCGGCGCCGCGGCCTTACGACGTCACCTCTGATCCCGACGTGGACGCCGCCCCCTCGATCCTGACCTGGACGACGACGACTCTACCATC
TGCGGCTAGCGCCATCTTCGCGCAGTACCCGTTGCACTACGTGCTGCCCCCCCCCCAAGGCACGGAGTTGGCCGAGATGAAGGAGGTGGGGCTGAGATCT
GTGGATGGCCAGACCGAAGGACCGTGCTTGGGGCACCGCCGCCGTGGGCACAGCGACTGTGCCAAGGTGATCATCAGCGCCACGCGTGAACGCTACGTGG
AGATGCTACTAGTCTGGTTTGGACAGTGCATTCTCGCCCGTGCTGGACATCGCGCTCTCGTGGCGGCGTCAGCACGCTCTAACAGTGCTGAACATGCTGT
TTGGTACGCTGCTGCTGCTGCTGAAAGATTTCTCGCTACTACGGTGCGGCGGCTGTGCATCACCATGTGCTGCGACTTCTTCCCGCTTCTGGTCGGCGTG
GAGATGCCCATCCGATCGCTCTCGCAGTGCCTGCTGCGCGGCGGCCACAATGTCATCCCGCTCACGTATACCGTTCCCGGATCCAAGGTCAGAGTGGCCC
CGACGGCGCCGCCAACACCCCACTCAGCGCGCGGGCGTGCGTTACATGACAAGCTGTACTACCTGCCGGTGATGCACTTGCTGGACATCGTGACGTACAT
GACGTTCGTGGGCCACTTGGCGTTGTTCCGGGCCATCCGCGTCCGCGAGCAGGTGCGGATCGTGCATGGCCACCAGGCCACGTTCACCCTCATGCACGAG
TGTCTGCTGTAGACCAAAGCGCTGTACCTGGACGTCAAGACCGTGTACACGGATCACTCGCTCTTCGGCTTCGTGGACGCTGCCAGCGTCCTTCTCAACA
AGATCATAAATTTCCTCGTGTTCTCGGTGAACACGGCCATCGGAATCTCGCACACGTGTCGCTAGAACCTCGTGCTGCGTGCGTCATTGCGCGAGGGGCT
CGAGAGTGGGTTTACACGGTTGGTGCGTGCGTCATTGCGCGAGGGGCTCGAGAGTGGGTTTACACGGCTGCTGCTCGAGGAGATGCTGGAGAAGCACCGA
CGGCACTACTGCGTGACGCTCTACGGCGCCGTGCCCGGCTTCAAAGTGCGCGACGTACTGTGTCAAGACCACATCTTCCTCAACCGACAGCTCGCTGGAC
AAGAGAGCCTCTACTTTACGATTCTGAAGGCTGCGAAATACGAGCTTTCCGTGGTAAGTACGCACGTGGGCGTAGTGTGGGAAGTGCTACCCCCCTGACG
TGGTGCAGTTCACAGCGGACATCACGCCTGAGGCGCTCGCGGAGGCGGCGCTGGCCGCGGAGCTTCGACTGGCGGGCGTGGACCGACAGGACTTCCAACG
CGCTTGAAATGCAGCTCGTGCCATTCCCCGATTTGCGTCGTGATGGCGACTCCACTGTACGACCGCGTGACGGTCGGTGCCGGCCTCATAGGCAGTGCGG
CTGCCTACTACGCCACGAAAGAAGGCAAGTGCGAGCTGCTGCTGGAGCATTTATGAGCTGATGCATGACAAGGGCTCGAGCCACGGCACCAATCGCACCT
TCCGCGTGGCCTTCCCCAACGACACGGACACAGAGCTGTATCTGACGTCGCTGCAGCTGTGCTGTGCGATCGAGAAGAGGTGTCTTCGCGTTCGGACGGC
TGGACGGCCTCGTCCTCCTTGAGAGGGCTTTGAAGAAGTGCAAGGTGCCGTTCGAGTCGCGGACTGGCGCTCAAGTGAATCAACGCTTCTCGGCTTCTCA
TTGCCCGACAACAGCCACGCGGTGTACAACGCGCGGACGGGGGTGCTCAATTCGTTGTTGTCAATGGCCACGACGCAGACGTTGCTGGGCGCGAGTATTC
GTAAACGCAGAAGAAGGTGTGTGCCCTGCCCGACACCTCGCTACTCCACCGTCTGCAGCTGTATCATGGAATCGGCTCAGTAGTGGGGGTGTTGGCTTGC
GTCATTGCTGTGGATTACATTTGAAATCTTAATCTAGAATAGCACTCTACATGTGATATCAGTGTGTGTTAGCAAAGCGTGTGTTATATTGTGAACGTTA
GTGCACCTTACGCTCAGAAGCAAAGCGTTTATTGTTGTGAAGGCAAGGACTAAAGAAATCGATTACTGCGAAATGTCCACACTCACGACTGCGTCCAAGA
GATACTCGAACTCCATGTCGTTAATGTCAAACAGAGAATCTTCAGCTTCTTGCTCGTCACTGTTGCTGTCACTGTCGCTATCGAGTTCTATCGGCCGACG
AGAAGTCTTGTACAATGGCAGTCGAGTTGGTTTCGCATCTCCGTTGTTCGTGTAGATGAACGACAACTTCTCGACTGTTGCGACCTTGAGGCGGTTTCGA
AGCTTGCTGTATGTAAATCCTTGCACACTCCACAGGCGCTCACTTGCTGCAGACGAAGTCGGGATGCTCAAAATTTTCTCTGCGAACTTGTGAAGAACAA
GAAATTGGTCGTCGAGTGTCCACCGGTCCAGTGGTGAGTCCTCACTAGCAGCCTCCCTCTGAGCAGCAGTCCAGTTCTTCTTCGTCTTTACAAAAGATAG
CAGCGATGCGCGAAACTGAGCTGAGCTCACGTCGGGTGGGAGGCCAAAACGCTCGGCAAGCTTTACAGCGGAGCGTACCGCCTTACGAAGCGGACTGTCT
TGAGGGTCGGGTATAGCTTCGTTGATAGGGCAGCTTCCGTCAGAACTGTCTCCGCTCGATCCGACACCACCACTGCCGTCAAGGCTACCGCTCGGTAAGT
TAGAGATGTCCTTGGACGGATCCAGCAGGTATGGAACCGTCGTGGAATCGGACGGTGGACGAATGAAGTCCCATCGACTAGCAATCAGCTTGCGAATTTC
ATCTTGGACGGAGCTGCCGGCTAAAGCTGCGATACCTTCAGTGTACTCTGGCGCCTGATACAGCCGAAGAAACTCGTGCAGGATCCTTGAGTTCGAACAA
GCATCCGTCTCCAGGACAGCTAGTGCTCGTGTAACCGGTTTTGTCAGCCGAACGACAACCTTCGCCTTGATCCAAAACTGCTTATCGTTGACAATACCTT
GAACTTCGTCCAGCTTCACCTGACTCTCTTTGTCCGTGTAGTGCTTCATAAGCTCCGAGTCCGCCAAAGCTGCCTTCAGCGTTGTCTTGTTGCGAACGAC
GCTCTTGATGCATTTTTCTTGAGCGTACCATCTCGTTGACACAGGGACCGCTAACTCGCCTGCCCTTCTTGCTTTTTGTAGCTGGCGCCGGTAACGCCGA
ACTCGATCGAGCAGCAGGTGTCTAGCGCGCACAAACTTGACGATGTTGATGGCCTTCTTCAGCACGTCTCCAAACAACTTGATCTTGAAGATATCCTTCA
GGAGCAGGTTCATGGCGTGCGCCGAGCATCCGTTGAAGACCACGTTTGGGTGCTTAGCTTCAACCAGACGGCCAGCCTTTTTCATGTTGGCTGCGTTGTC
CGACACAATGGCGGAGACTTTGCCAGCGCCGGCCACGCCTTCTACCTCAGCAATGACTCGCAGAAGCTCCGATGCCATGTAGTCCCCCGTGTGTGCCTCA
GAGCCCGTAGTACCCGATGACCACATCATTGGACGCATGGCGGGTGACCACAACACGTAGTTCACGATACTCTCGCGGTTTACGTTGGACCAGCCGTCAG
TGATGATAACCAGAAACGTTTGCTTTGAAAGAAGCTCAGCCAGGTTGGCCTTCTCCAGTTCATAGGCTTTAACGAGCAGGGTGGTCGCTAGCGCCTGCCG
GGTTGGGAGCTTCAACGCAGGAGTCAGACGCTTAAACAGCTTGCGCATGTACGCATTCTCGATCGCGCGGAACGGGATTCCAGCAGTGTAGAAGACCATC
GCGATGTCCAGATGAAAGCTTGATTCCTCCTCCTTGCTGAGTACGATTGGGGAATTTGTTGCTGGAGAGCCACTGTAGCTTGTGCGACGGCTCTTCGACG
GCGAAAACATCCCAGGCCTTGCCTTACGCTTCCTCTGCGCGTCGTACGTTGCCCAGGTGGCCTTCGTTGTCGCTGGGGCTCTGGAGCAGAAGCGGATATG
TGGATAGAGATGACGGCCGGGCTGGACATTCATGATCAATGCACCGCAGTGACGGCACGACACATCGGGGTGGGGCTACGTCGGCTTGGACTTCGGGACG
ACGACATCGAGCTCGCCCCATACAGGGTCCTCCTTGCGGCCCATCGGAGTCGCGGCCCAGTTGTAGAGGACTTGTGTAGCCCGTAGGAAGTTGACTTGTG
AAGCAAAGACTTGCGGGGATTTCGAGACGTGCTGCGCGCAGCGTGCGAGTAAGGAGAAGATGGTGGATGTGGTCGAGCAACCTAAAGTCTACACTGTATG
CCATTGGAAGCATTCCCCTGCACTCGGTCAGACAGCGCGGGAAGCCTTAAGCGCGGCCCACATCGAGGTATTCGAAGCGCTTAAAAGTGGAGTGTGTGAA
GGTCAACTTCAAGGGGATAAGTACCTCGATAATTACGAAAGTGACCGCACCATTTTTCCTATCGCAGAAAATATTTAACGTATTTAACGTTAAAAACATT
GTTTGCAATCATAGCTATTAACTCATTTTTAGCAGCATAACAACTCTAGCAACAAAGTTCCAGGAGAATGGGAAAGTTGAGCAAGAACTGATTTAGTACA
TCTCTATACTAAGCATGAGATAAAACCACCAATGCATCAATAGATGCTGCATACCAAGCTGGGCCTGGGTATGATGTCACCAAGGCTGCACTAATTAAAG
CAACATTGAAATGTTGGCGTTGCGTAACATTGAGCGCAACAATGGTGCCTCTGCCTAACATTGCACAATGTTACGGTATCTCTCGTAGCAAAATATTTGG
TTTACCAATGTGACAATAGTGGACGCGCGTCGCCACGACAGCTCGACAGCTCGACATCTCGACAGCACGACAGCGAAGCACGCTGTATCACTCGGGGCGT
GCGCCAACAGCTTCCGCCGCTACGCGGCAAGCGCGTCATGGTGTACGCGCCGACACATGCAGCAGGAGAATGGGCTCTACGGGATCTACGCGCAGCTCTA
CCTGGGCGCCACGTGTTGTCTATTCCTAGTTGGCAGGACACTCTCGCGTGGGCTTTCGCCTGCGGACTTAGCGTAAGGCACGAGGGGGTGGGGCAGGCCG
CACAGCGGCCCCCCCCCCCGAGCGAAGCGAGAGAGGGGCGGGCCCCCCGAAGTGCCGTCGCTAAGTCCTCGCCTCGGCCAGGCGCGGTGTCTAGGAAAAA
AAATATCGGGTAGCAGCGCAGACCCGCCCCCGCCTGATCGGCGGGTGTTGACGATCGGTGAACGCGCTCAGCGAGGCTCGCGCTCGCGTTCGCT