Description :
From Genome Similarity Track
Location :
Scaffold_345:12959- 14284
Sequence
1325 bases(100 bases per row)
CTTGTGGTCTCTTTGATCCCTCTGAATTCGCTTTGTCTACAATATCCCTACGCATAACGAGGGATGACAATGTATCGGATCGCGCAAATGCGTTGAGCGC
CACCAGCAAATCACACGCGGTGACCAATTACTGGAGCCAATGTAATATAATGGTCAAAACTAAAGTATTCAAAACAACCAAATGGTGCATTTGTTCGTAT
TAGCATCAATATGCTTTCGCCAATGCTACTCAATCCAACATCAACGTTCGTTCGGCACTTCTACAACCACAGCAGGTGTGTAGTGCACTGCCACCGCCAC
CACGGCGGTCGCCACGACAGAGCAGCGATTCGACCTCCAAGCAGCAACAGACGTCCGGGGCGGCCTCCCCACCAACAGCAGCAACATACACACCTGGCGT
GGCGACCGCCGTGGTGGCGGTGGCAGTGCACTACACACCTGCTGTGGTTGTAGAAGTGCCGAACGAACGTTGATGTTGGATTGAGTAGCATTGGCGAAAG
CGTATTGATGCTAATACGAACAAATGCACCATTTGGTTGTTTTGAATACTTTAGTTTTGACCATTATATGTACATTGGCTCCAGTAATTGGTCACCGCGT
GTGATTTGCTGGTGGCGCTCAACGCATTTGCGCGATCCGATACATTGTCATCCCTCGTTATGCGTAGGGATATTGTAGACAAAGCGAATCCAGAGGGATC
AAAGAGACCACAAGGAGAGCCCAGCACAAAGTAGGCACAAGAGATATTGCAACGGCTAACCGATATGGCGGGGTATAGAAATACCAAGGTGCGTATAGCG
AGAGGTAGCACTGGCTGAAGTGATGCTTTTCAAGTTTTTTTCTCGATGTCTTCGCTCCGATGAATATGATTGGATGCAAACTTCAAGAAGGCGATGATTG
GCGGAATTTTGGTGGATATGTTGAAATGCGCGCCAAGCCTCCCTCTCTAGTTGCAGCAGGATTCCCGCGCTTGGCCCGGGATTTCCGCGCCGCGGCAGCT
CCATTTCCAAACGTTATTTCCAAATTTGCTGGCACTCACTCACACCGACACCAAGCCTACCTACGACTATCGCCCGGGGTTACCTCTGCTGCCGTGATCA
ACTATGGCTCCTGCTGGCCTAGCTTCTGAACACCCCGGCAACCCTCCATATGATTCAACCCGCTACTCGTGGACGTTACTATCACCATTGCATACTGCGT
CACCGCTTCCCCGATCCCAACCTACGGTACGAGCACCCTTCGCAGGGTCCAGGCTGGTCTCGAGGCGTTCATGCTGCCGTAGACTATGTAGACGCCGTCA
CGAATCGCAATCGTCGCTCGGAGGC