Description :
From Genome Similarity Track
Location :
Scaffold_57:12957- 14357
Sequence
1400 bases(100 bases per row)
CAGTAGTCAGCCGCGTGATTGGGCACGGCTCAACTCCAACTCCAGCCACAACTACTGCTCGTCCCCAAAACGGCTGATCGCCAAAGAACGGCACAATGAA
CGTCGGCTTTCCAGCGAGAAGACCCGCAGCAGTCGTGCCAGCACCGCCGTGGTGAACGACCGCTGAAACACGTGGCATGAGCCAGTCATGCGGACAGTTG
CCGAGGAAGAAGACGTTATCCGGAACAGTCACCGAGCCGGCCATGTCGCTCCAGCTAGACTGGATCAGCACTCGAACGTTCGCTGCTTCAGCTGCCGCCA
TGATCATGTTGGTCGTCCCCAATGGGTCTTGAAGCACCATTGAGCCGAACCCAACAAAGATTGGGCCTCCATCGTTACCAAGAAAGGCTTCCAGATCTGG
TGAAGGAGTGTATTTCGACGCCTGCTCCTTGAGCGTCACGGTTCCGACGACATCGTAGATCGGACCCCAGTCCTTTGGCTTCTCGACGAGATGAGGACTC
CACATGAAAGCATGCGGAATGCCGAGGTCCAACAAAATGTCTCGACCGCCGTCACCCTTGCGGATCTTGCGCAGCCCCAGCACATCCGTTCGGAAATCGT
TCACCATCCCTTCGACGCCCTGCCACATGAGGAGGTCCACCATCTTGTACGACATGTAGTTGCGCTTCTGAGGTTTCCACGTGTACGGCAGATTCGACAG
CGGGTGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCGTCGATCATCTGCATGTTTCGCGGCACGTCCTTCTGGATA
GTCTCGAGCTTCAGCGGGATCAGATGGCCACCTGTTTTGACCATGTAGGCTGCGAGCTCCTTCGGGTCGCCACCGAGCGGGTAGAACTCGACGCCGTGCT
CTGTCACGAACTCGCGGTACACCGCATGCGTAGCCAACCTAACTCGGTGGCCGTCTTGCTGCAGGCGCTTGGCAATGCCGATGAACGGCTGCACGTCCCC
GCGAGTCCCGACGATCATGATGCAGACGGTCATCTTGGGCGGCACAACCAGTGGTTCGTCCTCTTGACACTCGGGTTCTTTCGACGTCTCGGCGGCCTCT
TCAGTGTCGAACACAGTCGAGTGGCGCGAGCGCAACGCCTTGATGTCAATGTCCTCCTCGGCGGCCACGTCGACGCAGATGCGTCCGTCCGAGTCGAGCA
CCGCGATGCCAGCGGTTTGGATGGTGTCTGCGGCCGCCTGCGCGGCCGGCGGCGCACCTTCCTCGCGCTGGAATACAGCGCGGAAGCGCTGGTTCCATTC
CTGTGCGTGTGTGTTGTTCATACGAGGTAAGTAAATGCTGCAGCGAAACGAACCAAGGCGTGCTTTACCTGGAACTTGCTCATGTTTCCTCGTCGGTGCA