Description :
From Genome Similarity Track
Location :
Scaffold_389:12951- 16528
Sequence
3577 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCAAAGACAGTTATGAGGTAAGACTAAAGTGCAGATAGAAC
CCCAGGAAGTGTCTGGCCTGTGGATTCGTCGAGTAGCAACACCCCCTTCAAGACCCGCTATCGGAAGCAGTCTCCCTACCACGCGGCTGGGGGGACAAAG
TAAAGGCCAGGAGGTTAACACCTCTGAGAAAACAAGGAAAAGGCCAGGAGCGACAAGCTACCTGAAGAACTTGGTTGGAAGCCCACTCTCGACTGAGTCG
ATCGAGTGGCCACCTGCCGGCCCACCCAGCGACGCATATCCACTTGGAGCCCAGGTCTACCTCTCTCAAGCCCGAAACATCTTCCTCTCCGTCCGAGTCT
ACCGAAGAGTGCAACCCTCTGGTCGACGGGTACACAAGGTAAGTCAAAGTCCATACGCGGAATTGGGGTACCCCTGCAAGTCGGCAGTCCGGCGCAGTGG
GTATTTTGGGGGCTCAACACGCAGTTTTGAGAGCCCACTCCAGCTCAATGGTGCGCGTACCTGGATATTGAGAAGATGCGGGATTTTACCGCGAGTCCCA
AGGGGAAGAAGATGCTCAAGTCGAGATTGAGGAAAAGACTGAAGAGTCACTGAAAGACCGATCGCCGGCGACTAAAGAAGAAACAAACAAAGAATCTAAG
GACCGACCGGCGCTTGGGTGGGGTCAGGTCAACAAGGTCAAGGTTTAACTTATTGAAGAGATTCCTAAGTACCCTTTCTATGTCCTCTCGGATGACACCT
TGGGTCATGAGATCTATCATGCCCCAGAGGACCAACAGACGAAGGCAAAAGTCGAGATGCTAAGGTCCCCGAANNNNNNNNNNTCATTAAAAGAAAACGA
CTCCTCTCTTTGTATGCTGCATAATACTGTTTAAATATGAATAGTATTTTTTGAGACGTGCTCTGTTAACCCAAAGATCACCCAAAACAGAATTCGTCGT
GTCTGTTATTGTAGATGCCCCTCGGCCAGAAAGTGGTGACCGAACGGCACGATAGACGATTAGTAATGCGCAAAGTGGGGATGACTAATGCGCGACTGTA
CGATTAGTAATGTGCGATGTGTGATTACTAACACGCGACTGTACGATTACTAATGCACGATGTGCGATTACTAATGCGCGACTGTACGATTACTAATGCA
CGACATAGCGATTACAAATGTGCAGTTGAACAATCTAGTAGGCCTAAAGTGGTGAATGAGTTTGCGAACTAAGGACCAGGATACATTCACTTTTCAAATT
TACATCAAGTGCTCAACTGCATTTGCCTTTAGGTTATTAGCCCAAGCCCCGTTTCCTCAAACGGAGACTCCGATTACTCCTTCGCTATCGACGCCGCCTC
AACCCAGACTTTCCGCATCAAAAAGTTTCAAGGGACTAACCCTCACACATGGAAGTCAAAGATGCAGATGGTTCTGGAAGAGCGCGACCTGTGAAAAGTT
AAAAGCGGAGATTTCAAGCTGGAGCACTGCACCAACGCGATTGACCAATCGACGTTCAAGAAAAAGGCGCGTAAGGCTCTGGAGATCAGCTGTCTCGCTA
TGGAAGAATCGTAGCTGCTGCTGGTCCGTTCAGCGATTGGAGCGTACGATGCATCTTTAAGACTGGAAGGGCACTACGAGAAGAATAGTATGACGAACAA
GATCTTTTTTCGTCGGCGCTTCTTCACGACGATGATGGATGAAGGTGATGATGTGCTGGATCACATCGATGAGCACAAGACTCTGACGGAGAAGGTTGAT
GCCATCGGCTCTCCGGTCAGAGAGGAAGATTTGGTGCTCACGCTTCTGGGTAGCTTCAGCAAATCGTACCAGTTTCTGATCGCGGCTTTGGATTTACGTG
CCGACTCGCTTTCGTAAGAACTCGTGACGTGTTGGATGATGCATGAAGAGCAAGGAACAAGGTGGTGGCGTCGATGGAGTCGCGCACGGTCAAGGTCAAG
CGTTTATGACAAGCAATCAAAGCAAGTGAAAAGGAGAGCGGCCTATCCAGAAGGCCACTGCATGTCACTACTGTGGTGAGCAAGAAATCTGTATTGCCGA
GTGTCCAGTGAGGATCCGCCAGAACGCGAAGCGGCAGAGGCCACAAATATCAAGCGTCGCGCAGGTTGAAGGAAAATCTGGCGACATTTTGTTTTGAGTT
GTTGGTCATGGCATTAAGCTGAGTGAAGAGTAGCTGGTTGACTCGGGTGCGACTCAGCACATGACGTACTCGAAAGAGTACACGAGGAACTACTAGAAAA
TATCGCCATTGAACGTGCATCTGGCGGACGACGTAGTGGTACAAGCAGTGGGCAAGGGCGACATCATCATGTCGACGAAGACTGAACACGGCGTCAAGAA
AGGTGTGCTTACTGGCGTGTGGCATATCCCCAAGTTGACACGCAATTTGTTTTCTGTTGAGCGTTTCACGAAGGACGTTGGCCCAGTTACATTTTGAGAG
TGAAGACGATTTGCTCAGGCGAAGAGTGTGAAGTGGCATCTGAGTAACTGCAAGGGAAAGGGTTTATCCAAATTATGTATCTCCCGCTCATGCCAGACGA
GACAAATTTTCAAAGCTCAACCAGTTTCAATAGAATCACCAGTTCGTACCTCTGGTATCTTCGACTTAGTCATATTGGTCATGGCGGTCTGAACAATATT
GTCAAGAACGGCTAAGGTAGCGGCAATAACATCACGTCTTGCATTAGCAAGGGAAGTGTGATGGGTTTGCTCTTGGCAAGCAAACGTGAGCGAGCTTTAT
TTTAAAGTCCCCAGAGCGTGAAAAGAAGATTCTAGAAGTCATGCATATCGATGTCTGTGGTCCTATGCAAACAGCTACATTTGATGGCAGTAGAAAATTT
GTCACGTTCATTGAAGAGTTTTCACACTTTTGTGTGGTGTTCTTGCTCAAGAGCAAGTCTGAAATGGCTGCCAAATTTGCCGAATTTGTTGCATTTGCAG
AAACTCAGACCGGAAACCGCGTCAAACTACTTTGTATTGACAATGGTGCAGAGTACAAGTCACGTGGTATGACAAGCTATGCAGCGGTCGTTTTATTATA
CAAAAGTTTACGCCTCCCTACACACCGCGACTCAACGGAGTGGCAGAGTGGATGAACAGGACGTTGTTGAAATTCTCTCGCTGCATGTTGGAGCATGCTA
GATTGTCCAAGGAGCATTGGGGCGAAGAGGTCGTAACCGCTACATTTATTCGCAACCGATAACAAAAACGTGCCACTAGTCAAGACAAGACGCCACATGA
AGTCTGGACTGGCAAAGAATCACTACTTTCAAATCTGACGTTGTTCTGTTGTTACGCATACGTGACAATGAAAAAGCAAATGCGCACCAAGTTTGATGCG
CAGTTATTCGGTTGCCGCAACATAGGATACTCAGAGCCCGATAGAGCGTACATCTTGAAGAAATCAAGAGCCGTCGTGTACTATCGAGTCGCGACACGAA
ATTTATGGAAGACGTTTTCGACCGTAAGAGACGTACACACGGAGAAGTAGAAGATGTCGTGAACATTCAAGAAGATG