Description :
From Genome Similarity Track
Location :
Scaffold_1295:1295- 3531
Sequence
2236 bases(100 bases per row)
GGCGGCGCCGCTAGCTAGTGTTCCTCTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACT
GGCATTGTGGTCTTTGTTGACCGATTGAGCAGGATGGCTCATCTAGCGGCAGTGCTGGACTCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACC
GTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCGCTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCAC
CCGTTTGGACATTTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCTTTATTAATGCCATTTTTGTGCAGTGTTTGCGCTGA
TACGCCTATGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACACTGTTCATGCCTCTACAGGCTATACTCCATTCTACGTAAACGGT
CTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTAGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTT
TTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTACGACATGTGCGTGACGCAATGGCTGAAAGCCAAGACCATCAAAAACAACAAGC
AGATGCTAAAAAAAGAGGTTGTATTGAACGTTATCAAGTCAGAGACCAAGTATTACTCAATGCTAAAACCTACCTACACAAAGGTAGTGTCCGCTGTCTT
CAAGACAAAGTTGCGTCCGCGCTTCATTGGACCATTCACGGTCGTTGCTAAGAAGGAACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACAT
CCGGTGTTCTACACTGGCTTGCTTAAGCCGTATCGGGATCCGTCCCACGTGAACTTGGAGGCGCTTGCGCCGCGGAAGTTGGCCTTGCCATCGGTTGCTG
CATCCGAATCAGGAGGTCAAGCTGGGCCTCCATCCGGGTGTCACCCAACTCCAACGCCTGAAAGCGAGCTCGCGTCGCGTCGAGCACATCTGGGTCTTAC
CCAATGTCTCACGGAGACCACTCAGCTCGAGAAGTACCTTCTCATGCTCCTCCTTTGGTACACCGACCTCCACCGACGCTGCTCGATTAGCAAGGGAACC
GCCAGTTCCATGTGGAGAGACTCCTCAAACGACGTCGTCGTCATGGCCAATACCAGTATCTGGTAAAGTGCCGTGGGTACCCGGAGTCGGAGAACTCATG
GGGGTATGAGGTTCCCCTTCGGCAAGACTGCTCATACGCCGTGGATGTTTTTGAACATCGTGGCCAGTGTCATCTCGAGACTGAGGCCGTTTCCCACCAC
TAGTGGTGTCGACTGGCGTGTTGTCGGTCACAGTCGGACCAGCACTCGCGGCTATCGTAGTAGCCGAAGCATAGCGCGTGCGATTGCGTAATTGGCCTCT
GGCGTTAAGCTTGGCATAGCCATACCGAAGCTTGCGTTCGAGACGCACATCGGCCACATTGACACTTGCTCTCAGAGCGTACATACTGCTGAGGCGACGA
GTGCGGTGCACCCAGCGAATGAAGGTGTCGTCTTCTTAGTCCGTTGTTTCGCCTGCGAACAAGAGAATGGGTATACCCTTAATCGGTGGAACCGGTGCAC
CACGTGCTTGTATCTCAAGGCGTGCCTTGTGCTGACTTTGCGTTGTCAGAGATGGCTCCAGGTACCTCTCACGAAGTGCCTGGCCACTTGCCCCTTCCTC
GGGAGAAGTAGCTCCAGGACCAATGGGCCACGTTGCCAACGTTTGGCCAGTCGTTTGACGTAGACGTTCCTCTACACTGAGTGGAGTGAACACATAGTCA
CGCTGGTTCTCAAGGGTCGTGACCAATTTGTGCATGGCGCCGAGCGCTTTCATCTCGTTGAACAGTCAACTGTTGCTGCTCATCGAGCGAGTTGGTGATG
ATTGCATCATCCGAACCGGGTATTAAATGCGGCGCCAATGGCGCATTCGCATCATCACGTTCAGTGAACGGACTTAACGTAGTAGGAGGTTGTACCTCAG
ACATGAATGTATCAGACATTGTCCTTGCATCACCCTGATACTGGTATCGCTACCATAGTCCATTGCCTCTCATCCCGAGGTATGCACAAAGAGTCTTTGA
CTCGTAGACGATGAGGAAATAGTACTAAAGCTTTGC