Description :
From Genome Similarity Track
Location :
Scaffold_66:129479- 131047
Transcript NameFunction/comments
g10867.t1XP_009521393.1 hypothetical protein PHYSODRAFT_555600 [Phytophthora sojae
g10868.t1XP_008896308.1 hypothetical protein PPTG_04200 [Phytophthora parasitica INRA-310

Sequence
1568 bases(100 bases per row)
CAACCACATCAAGCGGAACTGTCTGCAACAGAGCTCAAGCGTGGAGCCGTGGCTTCCAGTCCCAGGAATCGCAGCCAGAATCAAAAAGACCAGCAAAGCT
CCACGCTGTCACCACCCAAATCTCCGTCGTCCCCGACGCCGCACATGTCATTAGCTGAGATCGCGGAGAACCACGACGCCGCTGAGAACGTCGTGTAGGT
AAAAGTGTAGTGTAGCCATGTCAATCTGGAATTCCAAATTCAAGAACTTCAGTTCGAAATGAAATTCTATCATCAGGCATATTCCTCGCGCAATACTTTC
GAAGCGCATACATGAAAATGGAGACGGGCGGTGGCGTGTCTAACGAGATGATGGCGCTGTACGAGGCGCAGCGCCGCGCCCACGAGACCGTGTTGACTCT
ACAAGCGCAGATCGAGGAGGAGGAGGCTGTGTACCTGGAGGAGACACCGCACGGCAACATCATCCGCGGCTGGGACGGCTTCATCGACTCGAAGCAGTCG
CGCAAGGACGCCAACCCCAAGAAGCTCAAGCCGTACGTGGAGTCGGAGCATCTCTTCTCGAACTGCTGCTTCTACGCCAGCATGGCAGGCGAGCCGAGCT
TCGACCAGGTGGACATCTACGGCACGACCAAGGACGAGAGCTCCAGTCGACGCAAGCTCACAGTCACGCTGTCCGTGGGGAAGGGGGCGGGAGCCATCAG
CGGTGTGGTGGACACCTCCGCTGCACACAGCACACACGCAGCTTATAGAGGAGGGAAGGGGGCCTTGGTGCAGAAGACTGCAAAGACTGCTACACATCCA
GCTACAGGAAAAGGAACCGCAGCGATAAGCTCCCAACACAGCTCCAAGCTCAAGAAGCGGAAGAGGGAGGCAGGAGATGTCGCTATTTCTTCTGCGAAGG
CACATGAGACCGTGGCAGGAGGCCCGCAGCTTGCTGCAACTGCAGCGACGTCAGCGGCGCAGCCTCCTGCGAGTGACTTTCTTGATGTGCTCTAACCAGA
TAAGCAACTCGTTTCTTCTACGAAGTATCAAGAAACTGCAGCAGCGAACGCATGGCACAAGGTCGACTAAAGTGTGCATGAGTCTTCTTCAGTCTTATAA
TAAACAGCGGAATCGGTGAACAGGTAGGACGTACGACGGACATCACATCGCACCAGCGCTCCCAGGTTGGCCTGTGGCTCGATGCTTTTGAGCTGCGTGT
CGCTCTCCAAGAGAATAGATCAGGAGGGGTGGTGCTGCGCTCACTTGGATGCGTCAAAGGAAGCAAGCAACACTTCCAAGTCCTTGGTCGTCTGGCGGAA
GAACCCGTCGTAGTTGAACTGTTATCGCAGTAAAGATCATAGTTATGAATCAGCAACCATACCTCAGCAACGTGTCTGGAAGTCACGGAGCGCAGGCTTA
CCTCAAAAATGTAATCCAGCTGCTGGGGTGGCACGGTGATGTCCGGGAACTTCGTGTAGCCCTGCGTCCCAAAACCAAGCAAACGTCAGTAACACGTCCG
CACAAAACAAGCACACAATAAACCACTACGCACCCTCAAACGGTCATTGACGGTGGTCACGGCCTCCA