Description :
From Genome Similarity Track
Location :
Scaffold_102:129473- 130832
Transcript NameFunction/comments
Physo_141700hypothetical protein

Sequence
1359 bases(100 bases per row)
TGAAGTCGATGCGGTTGAAGATATCCCCATTGTGCCCACAAAGCCACACTTGCAACGCTAGTGAAGGGTGCCTCTCTCGGACCGCTTCTAGAACCGGCAT
CAACCTGTCGCGCATGTACGGCTCGCACCAACTGCGGTCCACCTTCGACTTGTACGGATTACCAATGTAGATCTCAGGCTTACGACGACAAGCCGCCGCT
CCAAGATCCTCCTCGCTCGTTTCCGCAAGTAGCTTCAACAACTCAACTATCTCGCCGTAGAATCGGGGAGTTGCCTGCAGAGTGCGCTCGTGGCCACTCA
CTCGGATCTGAACAGCAAGGTCGTTCTTGAGAAACTCTTGGTCTTTCGAGATACGCAGGTACTCGAAAATACCCTTGCCAGTCAGACGAGCAGGCGCCAA
CTCAAGCGACCGTAGCGACTTCATCGTTGCCAGGGAGATCAAGGTGCGATCAGTTAGCGTATCGATGGACTTGACGCTGTAGTTGGCATAGCCCGAGCAA
TCCGACATCGTAATTGTCTCCAAATGTGGACAGCGATCCGCCACTGCCCCCCAGAACTCGTCCCCGTACAACCTCGTGTTCACGTAGCGAGACCTGGCAT
TACGTCGATAATCGATCGCAATCGATAGCTTTGTCAGCGTGGGACATGCTCTCAGCACCGCAGTGATCTCCGAGACCAGCAAGCCGTAACCAGGGCGACT
GGCCTCAACGTCTTCCTCGTCGTCGTTCGGAGGTGGAGCCACGATCTGGCCATCGCACTCACGGAAGTAGCGATGGTAGTTCCAACACTCGTTGGCAGAC
AGCGACAACTCCATCAAATTCGGCTTCACGTGGTCTCCGAACACTTGAAAGAACGGATCGGCAAAAGGAACAACCGCCCAGCTAAACTTCTTCAAACTCG
TGCACGTCTTGTTGAACTTTTCCCACGTATCCAACGTGACCGCCCACATGTCGTAGCACTGGGCGTCCCCGTGCACCTTCATCTTCTCGTAGCCATCCAA
GAACTCTATCTGCGGACAAAACTTCATCACGGCTTCGAGAAACTCCGTCGTGCTGCGAAGCCGCTCCACTTCGTTCCTTGTCGGCACCGTGAGCTGTCGT
AGTCCAGCCCCAGTCTTTTCGTCGTGCCACCTCTCCAGCGCTTGATACAAAGTCGTCGTCAACTTCTCGATTGGAGCTCCATACACGGCGTTCGTGTACT
CGTAGTGGTTTTGTAGACAAACCCTCTGCTAGGTAGAACCAGCGCCTCCAAAGAGCAACAATACTTCGACGCCACCTCTAGAATCTCCAGCACGTGTCTA
CTCACCAACGACAACTTGGTCAGATCGAGTCTCTTCAAAGTGGGCAAGTGTCTAAATAC