Description :
From Genome Similarity Track
Location :
Scaffold_223:12944- 17917
Transcript NameFunction/comments
Hyaar_Emoy2812878AlNc14C40G3439

Sequence
4973 bases(100 bases per row)
GTCGCCATTATCTGGCAGCGAGAGCTCCAGATGGCGCTCAATATCAGTCCAATCGTCCTTCGACAACTTCGTGCGGGTAGAAGCCCGCATTCGGAAGGAG
ATCTCATTATTCAGGATAACGTCGTAGCTACCACGCACGTGACGTCTATGGTAGATGCTGTGCAGCTCCCACTGACCATAGACGAGATGGTACTTCACCT
CATACGAATTTCCGTCCGCATCTGCTACATGCATCACAATCAGTTTACGTGGCTCCACGTCCTCCTCCATCCACTCCTCCAGGTCGTCCATCAAATCAGA
CATGCAAGGAGTCGCGCGTGAGCAGAAATTCGACCAGCGCGTTGAAAAGTCGTCGTAATTGCGAAGACGCTGCAGCTCCGGCCACTTAAGCGTCGAATTC
TTGTAATGACTTGATCTGAGCTTAAAGCACGTTTTCCCAAATGCCACCCTAATGTCCACGGGCAACTCTGACGGGTTCTCGACTAGATACGCCATGACTT
CAGCCGTATCGTCTTCACGAAACTCCTTGATCCACGACTCATCCTGGCTCGCAGTTTCTACTGCCTGTCCGGACTGCTGCAGGCGATACGGATACTCTCC
AATTTGCGCATTGCTTGAAGCCTCCTCGTCTTCCTGAAACGACCACAAGTGAGTGGGTCCATCCTTTGCTAAGATCTCAAAGACCCGATCCTTGGCTATA
GCGAACGTATCAAACAACTCCGCCAGGTCGTCTACTGCACGTTCGATGCCGAATCTCGACCCCTTCAATGTCACTTTTCGGTCTGATGCACCCACAGCGC
AGCGAACGCCATAATTCTGGCGAAGCGCTTTGCAGTAGCTACCTCCTTTGCCAATGACAGCCCCAACTGGGACATAGTCGGGAATCGGTAGGTCACGAGA
ATTCATACCGATACGTTAAAGCCAAGCAGAAAATTGTAGAGTGAGGCAACGGTATTCGTTCGTGTATAGTCAAACGAGATGAACCCAGCCATTGCTTGAT
GGATGAAATCTATCAACTGACTGCAAAGTCAAGAACTATCATTGATATCACATTTCAGTAAAGTTGGCTGTTGTCGGCGAAAAGCCTGAAGCACATCAAG
AACTTGGCGTGACGCATCTTGCCGAAAACACCCGCGAGCTTGGAGACGCCAAATTGATAGTGCTATTCATGTCCTCTGCTGGGTAATTTACTTCACTGGC
GATTACTCGTACGAAACTTTTTCAGTTTCTTTGTAGCAGCGCGTGCTTACGGCGCTCGAAAGTAAAATCACTACGGATGAGTTGTGCTTGATAGCTGCAT
ACTGACTGATTCCTCAGATGACATATGCATGATCGAAAGCTTCGACATGCTGTTGACTCATTCGATGACAAATGCAATTTTTTTCGGTACTGAAGGGTGC
GCCACAGATAAAAGCCACACCGTGTTATAAACATTTCTTTTTATTTCCTTGTTGCAGGTATATGATAATCCCGATGGCGCACATGTGAGCAATACCATGT
ATCTCGGTTGGCCAGCGCCACGATTCATCAATGAAGTTTTAAAAATGCGCGGCGCAAGTGACATCTGTACACAAAGTTTGACGGGCTTTGATGTATTATT
TGAAATTACAACTTTTGTGCATGTTGAAGTAGTCAAGGGTTCAGTTTCTACAAAACTTATTGCTCAAGGTTGTTGATAACTAGGATCATGCGTTGTTCTG
ATCTCTTAAGTTCCACAAATGACTTCACCAGCACAACTTGAGCTAGCTTGTAGCTTTTCATACGTCCCCTACCACACGGAGCAACGTGTCAACATTGAGA
CTCATCATGTGCACCACGTTTTTAGCACTGGACTACTGCAAAACGTACATAATTCGTGTACTCGCTATCGTAAAGGGTACCACTATCAATTGTACAAGTG
AGTGATCGCTATACCCGGTACACATGCAAGAAGAACGGGAAATGTACGCCGATCTCCTATATAGTTTTACTCAATCACATATACCCAGTTTTTGTAGCAG
TTACTATACTTATTTGCTTGCTGTAAACTAGCAGTGCACACTATAAAGCGTGCTTATAGGAACGACGAACGTCAAAATCGAGAACATTGCCAGGTTCCTG
AACACCATGTGGTTATGCGCGCGATTGCTTGCCGTTCGTACATACACAAAACCACATGAAATCCACTACCGCATCCAGTTTCTCGCCAATTTTGCTGCAT
GTGAATAGTCCAGAACTGTTACCGATACAGACGTAAATTATACAGATAATATGAGAGGGTTGCGGAAATATCGACTTGATGGATGCGCGCGCACAGCCAT
TTGAATGCTTGGCAAAACGCGAGATCGGGATATAGGAAGTAAAACAAAGTATCAAGTGGATGCAAGCTTCCTATTGAAACAGATGTCGAAGAACCAATTA
CCAGCAAGCGCATGCTGCGGTCATCAACCAATCTCGAGAATCACTAGACAGAAACCATCATTCCTGAATTTCATCGACAAGCCTCCAGACCTTGTCGTCT
ACTGGTGCATAGGAATTGCAGATACTATAGAAAAGTGACACGCACGTTGCATGCATCTGGGATAATGGCTTTGCAGAAGGGTAACGTAAGGGACGGTGCG
ATAACAGACGTAGGAGGCCTTGTTTACTTGTGACCGACCCTGATGAAGGTAACTGTATATGCATCAGGACTTGAATTCAAGTTACACTGTGCGTTGTGCA
ATTCAATTTATGTGGGATATTATATGCGCGATTTGTAGAAGATACGAAAGGCACCAGCTCCTGCCTCTAGAGGGGAAAGCATCGTCGAGACGGAATGATC
CTTCACCGTATACCTACAAGCCGGGGGCAGCGAAGTTCAAGCTGCCGAAGATCTGGGCTATGGGAAGATATATGCTGAGTGGCTGAAAAACTACCAACTA
CTTGCTTTGCATCGAGCAGTATACAATAGCTTCGTCGGCGAAAGAATAGACACGTCAACCGAAGAACAATTTCGACCCGATCAAGTTTTGTTGGTCATCC
GCTCCAACAATTAACTCTGGGGCAGAAGATACGATCTCGAGTAGCAACTTCCACGTAGCAACACTTACGACAATTGCAAGTATACAGCAGGCGTCGCAGA
ACGAATAACGTCAAGGACGGCAGTGAATGACGAGACTGCATTGGACGAGCACGCACAGCAAGTTGACGTGATCAAAATTTGTGTAAATAGTCCAATGAGT
CCAAATTTGAAAACGATGTCAGGTCTCAAAACCTTTCGTAAGTCTGTCACTCTAATTTTTCAGATAACAAGAAAAGTCGCTGCAGAAAGCGCAGTGACGC
CACCATAGTATATGATTGAGCCCAGGCGACGACCTAGGGGCAACGACGTATCTGTAGTCTTGACAAGAAGATCAAATGTGAACTACGCTGACGAAAATGA
CGTGAACTTCAGTACCGCTGACGTTAGTGACGTGGAGCATGAGGTTGCAAATTCTGAAAATAGCTCCGAGGCAGAAGAGACAAATGGACAAAAACAAGCG
GAGAAGAGTTGTGCCAGAGGGTTAGTCAATTTTTCAGGAGACTACTGATTGTGGGCAGAATAATTGCGCAACAAAGTAAATTGATGACGTAAGCAGAGGA
CGACGACCGACTTTTTTCTGGAGTGTGGACGAGGAGCATTTGTTATGTCGTGGCGTGGCAAAGTACGGTACCGGCAAGTGGAAGAAGATATTACTGAGCG
GTAAAGGTGTGTTTTCAATTCATCGAACGAATGTGGACTTAAAGGTACGATAGGGAGCTTTTGCACTAGCTTTGTCATTGTGTCTTTGTGTTGATGTGAT
GTGTCTGCTTCTCAGGACAAGTGGAAGAATATGCAAAGAATGAATCACATCAATTGCAAGCGAACCGCCGAAGTACAAAACTTGGCGCGTCACAAGCGGT
CTAGTGTAGCACATGCGACAAGAGTCGCTGCCGACCAATCAAGATCTGGAGGTGGTGTGGGCGAGTTGTCGTCAGTGGATAGTGTTGAGCTGAGAACTGA
CCCAAGCACTGCTATGGCTGTGGGCGCGATGGCTGCTACTGATCAACATGCGACTAGAGTTCGCTGCATTCCGGTTGAGGCAGACATATGTAATGCTGTT
GACCACGATAAAGGTGATATCCCCGATGCGACTGGATCGTTCCAGACACCACGCCAAGTTGTGTTACAGTTCGTATGCAACAGTAATTTTCCTGAGGTAC
GTTTTCGCTACTCGCATCCGTGTTCTTATAATAGAAAGTCGGCACTCGTTTTTGATTATCACTGTCACTTGATGCAGATTACAAATGTCCGTGTCGACTT
GGACACATGTAAGGATGTACCTACTTTAAAGAAGCTGCTACGCTCGAATATCTTGTCGGGTGCGCCACCGAACGAGGACGTCCAGATGATCGGCCTCACA
TCAAGACAGTTTTTTCAACATGACGAGCTTTTACTGCAATGCATGAGGATCAACAACGGCATAGACTTTTTTCTGGTGTTCGACGAAGCCGCAGCAGTGT
TTGTGTAAGCAAGTGAGTGGTTCTAAAACTTCGTGGCTCACTGTATTTTGTCCTAACAGACTTTGCGTCATCCATAGTTTGTGTGTGTGTAACAAGATGA
GCCCGTCTCATGACCAAAATTACTAACATGAAAGTACGGCAGAAATAAGATAGGGGTGCAAGCTCTGGAGCTCGCTCTTTGATTTAGGTAATCCAGTTCG
GAGAACTGAATCAGGTTGCAAAACACTATACAACAGCAGCAGTCACTGAAGAAGGAGTATGATGCTATTAATGTCTAATTTAACCCAGAAGTGTCGATCA
CATGATAATATTCACTTTTGATCGATTTTAAGCCAATCACGTGCATGCATCACAATAGTGACGTAGCCAAAGCGTGACTTTGAATATACAGTCGTCCCTC
CATATAAGAACCTCTATCGAGAATTAAATTCCTGTTTAAGGAACTCCGTGCCCCGCACCAAGCTGCATCACTT