Description :
From Genome Similarity Track
Location :
Scaffold_168:12941- 15299
Transcript NameFunction/comments
g8670.t1hypothetical protein

Sequence
2358 bases(100 bases per row)
GAATGAGCAGCGGTTTCAAATCCGCGGATAAAAAGAGTGGACGCGCGAAAAGATAGTACCGTCAGCATCATTGGTAAGTACGAATGGCTGCAGTAGACGA
CGGGTCATAGAGCGTCAAGCGGGCGGGGCGACAAGATGGAGGTGCTGGCTCAAGTGAGTGCAGCTTATGGGTGCAGATGCGTGGTTCTCGGCAATGCAGT
TTCACTGTTAGCCCCCCCCCCCACACACACACACACACATCTTACCCTTGTGGTCTTGAGGAAAGATTAAAGACGCTAAGTCAGTCATACCTGCGCCATG
TTCATTAACTCATTGCGGTGCTCATCCAGTAAGATCAGGCCGATATTCTCCAGGTATACGACTCGTTTTGGCTGTGCTGTTCATGGATAGCGCTGGTCAT
GGTTGCATGTTAACGAGTTTCATAGTCTCCGTACTCAATAGATCGACGATCCAGCCAAACTACGTGGGCTTTTACCTTGAAATTCCGAGCGGAGACAGTG
CCAGAAAAGTGAAGAAGGCCTCTCTACATTCAATGCGATTGCCAAAGCTGGCGGTTTTATCGTTGTGTTTTCAATGTGCTGCTTATCGGCGGTTAGAGCC
ATTTGAAACCCAGCGATAGACCAAAGACCCTGCGAGGAACAACCATCTTGTTTTGCCGTTCGTTTTGGCTCTTGATCTAGATATCTCGCCGACCAGCAGA
CATAAAACCCTACCCTGCCCTTCTTAGGACCTACTAGGTTCTCTTCACTTGCGGAGTTCGTGACGAAGTATATCCATCTACCAAGTACAAAACAGTAGTC
GTGATAGCAATAAAGGCGTCGACAAGCACGGAAGCAATGGCGTACCACCCCAATTTCGTTCTTGGCAGCAACCGCAATCTGCACTGAAAGATCAGCGACT
TCCTTTTTGTGCATCTTCAGCTCGGCACGAAGCGACTCGGCTGACTGCTGCTCGTACACCACCAGCTCTGCTTCAATCTCCTTCAAGCGAGCCAGCTCCG
CCTCGAGTTCCTTGATCTGCAGCTTTTGTTGGCGGGCCTTTGCCTGCAAGGCAAACATCAATTTTGGCGGTGGTGCATGCCAGAACGTGTCACTCAACGA
ACCTTTTGGCGCTTGCGATTGCCGAGTATCGCTGCTCTGCCTGACAGTTTGAGGCGAAGTTCGTCAAACTCGACGGCATTGAGAGTTTTCACGTGGCGAC
CGGACTTCTTGCTTGACGACAGACGTTGTGGCTTCTCACGTGGAGCAATCACTTCTCCAGCAAGCTTTTGAATAGACGAGCTCAGCCTACAGCATGCAGT
ACGCGCCGACATGAACCCGATAAATATCGTTACAGTTTGGGATTCATCTAGTCAAAGAGCGTCATATCGAAAACGAGGCACGCAACAACCATTATAAAGG
GAATGAGGGTTGCATACATTGAGTCTGGCATCTCATGAGCGAAATGTTCATCCTCTTCCTGCTTCTTCTCTGCTGTTTTTTCCTCTGCGTCAACCTCCAT
ACCTTCATTGTCCAACGTACTCGTCATCTCGTCGTCCGCTTGGTTCCTTTCAACGCCAAAGCTGCCAGCAGAGATGGAGTTGTTGGCAGTCTTACTGGCA
GTAGTCGAGATAGGGAGGCTCGTCGACAGCACCTGTCCGATCTCGGGCATCTCCACCAAGTCATCGACACTAAGTTCCAAGTCGCTCTTTTCCAGTGGAA
GCATAGCAATTGCCCTTGAGTAATAAACAGCAACTGAGCTGGGAAAATCTGTGCAGCGATGGTGCCGGTAGGATCAAGGACCGAAGCGCTACCAAGACTG
TACTTTGAGTCCATCACTCGCCCGCAGGAAATAGACATCGGGATGTGCTTTTCAAATGAAGCAAACCTTAACTTGGCAAATCGCTTGTCTTCGTCCAACC
GCACAGCGACGCACCACAGTGCAGCAACAGCAGCAGCCTAGCCGCGCGCGTCGAACAGGGACAGCAGAAGATCGCCATAGTCGCCGCTCACCTCAGCTCC
TTGCCGAGCTTCTTCTTGTACACAGGCTTGATGTCGCGCAGCACGAGGTGGTAGCGCACCACGGCCCTAACGCATCATAGCAATGCCTTCGTTGACTTCG
CCCATGGGCATCTGCTGAACAATGGCGCGCACGTTCAACCACATCTTACACATCAACAACGTACTCGTCCTGCTCTCCCGGGGGGTACATTTTCGTTTCT
TCCTCGTCCTCCCCCAAGTACATGAAGCAAGCAGTACGCCTCGAGGCCCATTGAAGCACCCGTCCTTCTTCCCAGAGCTGCTCGAACTCGCGCTTGATGG
AATCAAGGTGCGCCTGAACCGTGTGCGTCTCAAAAATCTATACATGGCGGGCTCCATT