Description :
From Genome Similarity Track
Location :
Scaffold_93:12937- 14529
Sequence
1592 bases(100 bases per row)
ATACTTTGGTGGAACCGCCTTCCTGTCTACCTTCTCTCGACTGGCAGCAGTACATATAATGAAACCTGCGGTAAGTTACTTTTGGGTCGTGTCTTAGTGA
CGACGGCTTCCTAACTTATGCTGTTGTTGTTGTACCGTCGAAGGGCGGCATCTACGTGGCGGCAGAAAGGAAATCATACCCTGCCCATCAGCGATGCGCG
ACTATCATCGCTGGATGGGCGGAATTGATATCCACGACCAGCTAAGGCTACAGCGCTATTCGCTGCAACTCGCGGTGCGCTTTCGAAAGTACTACAAGAC
GGTCTTCTTAGGCCTAGTCGACATGGCACTCGTGAATGCCTATATCATTTTCCGTGAGGCTCGGAAAATGGTTGGTGAAGGTGCTGATCCTGCCGAGTTT
CTAGCAGAGTTACAGGCGCAGCTTTTGCAGGTCACTTTGGCTGACTTCATTGATGAGGTATATACTACATGTTTGCCGGCGATCATGTGGTAGATGTTGT
ATCGTATCTGACTCGTTTATTATCATGCAGACATTTTCACCAGCACCTTCCGACCAAAATGTGGCCTCGATATCGGCTGCCCACAAATTGACCGAGTTTC
CAGAGTGGACCCAGATCCGGGAAGGTGTTCGGAAGAGGCCACAGCACCAGTCCAAGGTCTGCTCGATTCGCAAGCAGAAGGTCGGCCCGCGCAGTGCAAC
GAGGTCCTATTGCGAGACATGCAGCGACCGCAACAAGTAGTAAGTGTGACAGTGGCTTATGCAATCGTACTTTGACTATTTGTACTTCTTCATGCACAGT
GGCTACCTCTGTGACCGAGTCCGGCCGGGCCACTACCCAGGCAACACCATGACATGCCACCAAATCTGGCATGTCATCTGGAAGAACGGAGAGGAGCGGC
CTCACCCTCATGTTGGTCGTGGAATCCAGATGCGCAGCCCGGCAAAGAAGCGCCGACGCGCCGCTAGTGATAGGGAAGAAGGCAGCGGCGCGGAGGAGGG
AGGCGCTGGCAGCGGTACTGTGGAGGGGGGCGCTGGTTCCGACACTGATGTCGGCGCCGAAGAGAGAAGTGGTGGGGAGGGATGTGCTGGAGAAGACGAT
AGCGAGTAAGAGTGGGCTTGTCGATGAATACCTAACCTGATTTAATATAAATGTGTTGCAATCATTGATGACTGTACACATAGCCATTGCGCTTCGTACA
TGGCATGTTCGAGCCCTGTAAAAGGGACACTTCTTATATGTTGGATTTACGTCTTCTTGTTTGTTGGCGCAGCGTGGGTGTTTTAGAGAGCGTGTGGCTA
CATAGCGCTGCGAAGAAGCTCGCAGTCAATGTATCACCGAGCGTCTGATCTTCCCGCAGTGCAGAAAACGTATTCGTACTTACGTAGGTCAATACAAAAT
TCAAGTTTAATTTATTTCTAACATGTTGTATATACAACATGTGGGGTCGTAGACAGGGACCGAAAATAGCCGTAAGTGCGGGGGGGGGTTAACCTCACCG
ATTTTGGAGTAAATTCACCCCTGAATAAAAGAGCACTATTAATTAAATGAAATTTGTATTGACGCTGTTCTTACTTTTTCTGTGGACCACAT