Description :
From Genome Similarity Track
Location :
Scaffold_130:12934- 14612
Transcript NameFunction/comments
Physo_143124polyprotein

Sequence
1678 bases(100 bases per row)
TTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAGCACATTAACAAGCTCAAGACGCTGGCGGAACAGCTCGACGCGGTCGGCGCTCCGGTCA
GCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAATCGCGTTCCGACACGCTGACGTGGGA
GCTCGTGACGTCTCGGCTCCTGCACGAGGACATGAAGCGCAAGGAACAAGGTGGCGGTGCTGACGGAACCGCGCACGCTCAAGGTCAAGCGTTCATGACA
AGCGACAACGGGAAGCGCAAGGGACGGCAGGCGCAAGCGCAGAGGACGAGCGCCTGTCACTACTGCGGCGAGCACGGACATTGGATCGCCAAGTGTCCGG
TGCGGATCCGCGAGAACGGGGAGCGGCAGAGGCCGCAACGAGCGAACGTCGCGCAGGTCGAAGATGACTCTGGCGACTTCCTCTTCTCGGTTGGTGGCGA
CACGGGTGCCTCCAAGCTGAGCGGCATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGTACTCGAAGGAGTACATGAAGAACTACAAGAAGATC
TCTCCGGTGGACGTGCATCTGGCGGACGACGGCGTGGTTCAGGCGGTGGGGAGCGGCGACATCGTGATGTCGATGCAGACACCGCGCGGCATGAAGAAGG
GTGTGCTCACGGGTGTGTGGCACATCCCGAAGCTGTCGCGCAACCTGTTCTCCGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGA
CGGGTGCTTCGCGGAAACGAAGGGTCTCAAGTGGAAGCTCGGCGCTCGCGAAGGCAAAGGACTGTTCAAGCTCTGCATGACGCCGAGGACGCCCGCTGAC
GAGGCCAATGCGGCAAGCTCGAAGAATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTTCGACTTGGTCACATCGGCCATGGTGGTCTCGACGCCA
TCGTCAAGAAGGGCTACGGCACTGGCATCCCAATGACGTCGGTGAAGCAGTGAGAGGTGTGCGACGGGTGCGCACTCGGCAAGCAAACGCGAGTAAGCTT
CATGAAGTCGTCGCCGAACCGTGCGAAGCAAGTGCTGGAGGTGGTCCACAGCGATGTGTGCGGTCCGATGCAGACGGCGACGTTCGGAGGCAAGCGCTAC
TTCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTGGTGTACCTGCTACGGAACAAATCGGAGGTGGCTGCCAAGTTCGCTGCGTTCGTCGCGTTGG
CTGAAACGCAGACCGGCAAGCGAGTGAAGGTGCTTCGGAGCGACAACGGCGGCGAGTACACTTCGGGTGCGATGGCCAAGTTGTGTGCGGATCGCGGCAT
CGAGCAGAAGTTCACGCCACCATACACGCCTCAGCTCAACGGAGTGGCCGAGCGAATGAATCGGACGCTGGTGGAGTGTGCGCGCTGCATGCTGGAGCAC
GCCGGGTTGTCGAAGGAGTACTGGGGAGAAGCAGTGATGACGGCCACGTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN