Description :
From Genome Similarity Track
Location :
Scaffold_734:1293- 7698
Transcript NameFunction/comments
Phypl_g10637conserved hypothetical protein
Phypl_g10638RING zinc finger-like protein
Phypl_g10639protein kinase, putative

Sequence
6405 bases(100 bases per row)
CCGCGCCGACGAAGGGGGCGCCGCGCTTGTCGCTGTCGAGGCAtctggcggcgctcgccgcgctggccgccgtcgcggcgGTACTGGCGGCCGTCTGGAC
GTCGCCCGactggctgctgcgttggCTCGGCCGCGATGACGGCGTCTCCCTCGAATCCTCGCCTGCGAATgcgtcggcgttgctgggTCCCGCGGACGAC
GTCCTGGCGGACAAGTACGAgagcgacgtggtgaagaTCGCCTCGCAtccgctgctggtcggcgcggcggcgggcatAACGTGCCCGGAGTTCCAGCCGA
CCGGCGAAGGCTTTACGCAAGTGGATCTGGTGCTGGGTcgggagcagcagctacgagATCAAGACCAGGTCTTCTTCATGCTGAACGGGCTGAATGAAGG
GGTCTACATGCCCTGGACGTACCACCCTAGCGAGCAAGCGTGTCTCTTGGAGCTCGCACATTCGGCGGCACTGCACCTCGGAGCGGACCCGGACCGGTTG
GCCAATGGATTGAAGATCTTCTCCACCGACGGCTTGCCCATCCTcgcggcggacgagctgtacACTCAGCGTATTGCCCATGTTCTGCTGGACGGACAGC
TCTGGGTCTGGCCCGGGATCAAGGTGGGCTACGTGCGGGAGATCGAGGGCTGTTCGGTCACGACACAGTCGCTACACCCGAAGGTGTTCACCGTGGAAGG
CTTCTTCACGCAGGAGGAAGCGGACCAAATTATCTCCGAGGGCATCGGACATCTCTCTCGCTCCCCTGTTGACAGCCCCGACGCAGAGGACGGCTATCAT
ACGGACCGCACGAGCTTCACGGCGTTCCTTGATGACAGCCATTTCACGCGCGACTTCCGCGTGCGATCTTCGCGCCTTGCTCGACTACCGTCTCCTGGTT
ATGCGGAGAGGATGCAGCTTGTGCGATACGAAATAGGCCAATTCTTCCGAAAGCATGAAGATTACTTTGAGTCAAAGGAGTTTGTTCCGAGCAAGCGGTT
GGCTGCAGACCAGTTTGAAGCGTGGATTGGGTGGGCCTCGTCGAGAATCGAGGAGCATATCCAGGAGCATGGCGACAGCATTGTCTCCGTTCAATTTTTG
CCTGGAGGCGCGATGTTTCCCGATGCCCAGAGCACATCGACGTTTCAGCATGCGCTGCTGAAGGGATTTATGGAAGATGCCGAAGCGAGCAACTTTTTCT
GGGAGCACGCCGACCTGGAATGGCGAGATTGGATCGACGAGAACCTTGAACGGGAAGCAGACGACATCATGGGCCCCATTTTGGAGAGCAAAGGTTACAT
GCTGCCGTTCATCGTAGCATCATGGGAGAAGCGCGCTCAGCTTACTGAACTTGTTTATTCATTTCCCAACCCCCCGATCAGTGGCGTTTCGCACTACTTC
CGCTGGATACGCTGGGCAAAAGAACGTGTGCAGATGGGAATGGATACGCAGGCAGAGGCTGTTCCAAAGCGCGTGAGGCCCGACGGCGAAGACTACCCGA
CATTTTATTTGAGCTTTCAGAGCCGAATGATCAGCTATATCCTCGAAGACTATACTCCAGAATTCCTTGTTGAAACACTTACTGAGGATCTGCACTCGTG
GCTGATTGGAAACAAGGACAACGACGATgcgttgctggaggtgctACGTAGCAGCTCCTCTGCGTTCGACCTAGTGGTGGAGTCCTGGACCAagcgtgct
ggtgctttGTTCGCCTACGAGAAGCCGAAGTATCTGCACTCCTTCGAGCCGAATCGATTCGTGACGCTGTTCCTGTATCTAAACGATTGCCCTGAAGGTG
GCGAGACGGCATTCCCGTACTCGAAGGAGCGTTTGGTGACTGGAATCGAGCGGGAGGGAATGGCCGAGTGCTCCGATGGGCTCGCAGTGCCGCCTGTGAA
GCTCACCGCGTCGTTATTTTACTCGCAGACGCCAATGAATGACTTGGACCCAGCCAGTCTCCACGGCGGATGCCCACCCGCAAGGGGTGTCAAATGTAAG
TCTGTCGTGTCTGTCAGTATGAGTAAACTACAACTAAACAAGGTATTTGTGCATTGTAGTTGGCGCCAACTCATTCATGTGGAATGCCGATGCTGACGAG
GGCGCCAATGCGTGGGGCATGGGCGAAGACTTTAAAGCAGCGACAACACCGCAGTAATAGTGAAACCCGCGGGCAATACCGACGAATAACTACAAAATAC
ACAACAAAACCCGAAACTATAAAAAGCGAGCATCAACCgccaagacggtggaggacagcagcacgcaatTCGACACCATGGGGCACACGGCCAGCGTGAA
tcggcagcgacgcagctcgACAGGCACGCTCTATGGAGAGCCCGCgggcgcagctgcagcgccgcgcggGAGCTACACGCCGGCGCAGATGCAGGCGCTG
TATCTGAGTCGAGGAAGACCGGACATGGCCTTCATGTCCAACCAGGGACGCACGCCCGTTGACGTCCCCGAGCTGCAACAGACGTGCACGGTGAAGAACC
ACGTgaacctcaagaagaacagtctcaagctgcagcggtcTCCCacggagccgctgcagtaCGCGCTGGAATTCCAGTTCGACGCCACGAAACCCTGTCG
GATCAGTGTCTACTTGGTGGCAGCGGAGACCATCGACGCCGACACTGGCGCCTCCAGCTTTTCACTGATTCATGCAGACAAGAACCCAGTGCTGACCCAT
GACTTCCCTTCGGGGCTGGGGCAGATCTTCGTTCTTAAAGGGGgcgagaaggaagaggacgcagccaaggaggaggacaaagagaagcacgagcagcCTT
TGCCGCTCTTGGACTTCTCAACATACGACCTGGATGAACTGGTGTGCAAGACCTGCACGACGCAGTTCCCATTGATCATTGTACTCGAAGTTTCTTCGGA
CAGTAAGTGTGCCTAGTTGTAGCTGAGCGAGTTCGTCGATGTTCCTATGCTCACTGTTTTCGTTATGCTGTTGACAGGGAAACGCCCACAATCTCAGTCG
ACATTCTGCACGTTCGTCCAGAAAGGAGAAGATTTGTGGGATGTCAAGATGCTCAAGCAAAAAATCCTGGTACGAAATGGATAGGCATCTCTCAATCTCG
CCTTGGTTTAGTTTATCTCCAACTGACTCCCTTCATCGTTTCGTTTAGGTGGACGGACTGacgtacgagctgcaggagatctACGGCATTGATGgatcgg
tggcagcagcaccaaagACTGAGCGCAAGGGCGCAGATGGAGATGGCCAAGCCGACAAAAACCATACTGCCGAGGACGACATCGACATTCCTGAAGGCGC
GGAGTGCATTATCTGCTTGTGTGAGCCGAGAAACACTACAGTTCTACCCTGTCGACACATGTGCCTCTGCAGCGAGTGCGCTGAAGCATTGCGCAAGAGC
TCCAGTACATGCCCAATTTGCCGGACGCCGGTTGAATCGTTGTTACAGATTCGGGTTGAGGCTAAAGAGACTACGACGACGGAAGCGGATGACGATAATA
CCGAAGTAGAGGATGTCAAGTGATGTGATCTTGACGAGACAGCAACTCAATTATGAAATAGTTCTCGTTGCAAGCTGCAAATAGTACCTGTATGTAGTTG
TCTACAATACTTTAGACACGACTCGTGTCACAGTAGATAAGGATTCTCATCTCAGCACTACTACGTAGCACTTCGTACTTCCTCTGTTTAGAAATTGACA
CAGCAAGTCAATAGGCCACCACAGTACTACCTCTAAAGGTATGTCACTAAGGGTCCAACAACTTCAATACGTATGACTCATTTAGAAGCATAACGAAAGA
ATTTATCAAATTACTGGTTCCTTCCTACCTCATCCTTGTCCTCTCGCTGCGTGGCGCACCACCAGAATCAAAAGTTACCCCTCGGCTTCCGTCCTGGCCA
TCCCTTCACGCATCGATTGGCTTCTCTATCTGTGCAGACCTGCCCCCGCTGGTGACACGTTCGCCGCTAACGGTCCTGCTTCTGGGTTCCGCGCGCTTGA
TTTTTCTTGTGCGTTTTTGGTTGATTATCTTGTACAAATACTGATGGCGCTCGTCGGTGCGTGCTTGGCGGTGAAAAGACTCGACAAAGGCGTTTGGCCG
CTGGTTCACTAAGTTGGCGCCCTTCATTGTCGATTAGTTACACCGAAGCACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCCCTGGC
CTGTGCTCCGTCTCGCAGACTAGATCAAACTGATGCCGTACTCTTCAGACCCAATGCTGGGCTTGGGACCGCCTGACACCAGCTAATTGTTCTTTCTCCA
CATTCCCTTCATCTGCAAAGTTCCAGGCAGATCAAAGTCAATTTGAGAAATCAACACCCGGATATTTTGGAAAGAAAAATGACTTACCAAGTTGGCGACT
TGTTCGGGGGCATCACGAAGTCTGTTGGACGTCGACGGAGTCGAGCTGACATCGCCCGTTGGGCCATAGTAAGGGCTGCTCTGGCCTTTGGCAGGATAAC
CCCGCTGAGATCTTGACTGCTGAACTTCCTCTGTAGCGACTTTCGCACTCAGGTCACCTGAAGACTGCGACGGGAAATCACCAAGAGTTGGCTGTCGACC
GCCACGACCGGGAGGGCTGCCGCCATTGTTGTCTCCCCGTCGGCTAGGACTCTGCGATCCTCCATGACCAAAGTTGTTGTCTGCGCTGGAATTTGAATCA
TCGGAAGTTGTTGGGGATCCGACCTTAGCCGCGTTGTACGACAGCTTTCGCGTCATCATTTCTACCATCTGCTCCCGCTTTTTCAGCTCACTTTCGCGGC
GCATGTAGTCCACCTCCAACTCTGTAaatgcaaaaaaaaaatcggTGAGACCAACAGCAAAAGCCAGAATAAGATGCTCAAAACTCTTTACctttcagct
tcttctcacGAGCCATCAAGGCGGCCTCCTGCCGACGGAGGTCTTCCTCAATTCCCaacagctccttcatcttctggtTGTAGGACGTTTGCAGATTCGG
ATCGGCGGCCGGCTGCGGCGTGTTCGCCGCTGTGTACGCGCGTAatctctgctgcagctgaggAACACGCTCCAAGTCCTCAATTCTCGGTCGTCGCGAG
CGTTGCCTGTGGAGCATCCATCGGATGACTTGGAAGAGACCTTCCGAGTACTGGGACGGGATACGGGTGAACTTGCCTGCATTAATTTTTTTCGCCAGTG
CGAGCTGGTTCGTCGCGTCGAAGGGAGGGCCAAGAGTTGCCATCTCGTACAGCAAGCATCCCAGCGCCCAAATGTCGGAACGGTCGTCGTAAGTCATCTC
GTTCACCATCTCGGGGCTCATGTAGTACGGCGTTCCGACGTTCGTCTGGGCGAAACGAGACTCGCTGCTTAGTTCCTTGGCAAGACCGAAGTCACCAAGT
TTGGCATTGTTCTGTGGAGAGAATAAAAAAGTAGAAACCCAGTCAGAAATACAATACGCGGCGCAAAGAAAAATGCAGAGGCAGCAAACAAAAAGCCAAC
GTACGTTGGAGTCTAGGAAAATGTTGCCAGGCTTGATGTCACGGTGGAGAATGGGGCGGATGACGTTGCCCTCGCGATGACGGTGGCACTCCTTCAGCGC
CAGGAAGATGTGCGTGAAAATATGCCAGATGAAGCCCTCTTCGATGTAGGACCTGTCGACCGAATAGCAAATCCACCCACAAAAAGTCAGAAATCAACTG
GAGATTCTGCAAAGATACAAGATGCAGCTCTTGGGATAGGCATCGTGAGTGGCGTACCCCTcccgcttcttcctcttgaTGAACTGGCCGAGGTCGCCGC
CCTCGCAGTACTCCATGACGATGTAGATCTTGGTGGCCTGCTTGTCGATCACGCGGTCCAGGTAGCGGACGATGTGCGGGTGGCGCAGTTCCCTCAGGAT
gttcacctgcagcacgaaaGCAAGTCAGCATCCTTCACCCTCATCCGCCTCCCACGACACTGGGAGAGCGCTGACGCACCTCAGAgacgatgagctgctt
ctccttctcgctcatGGCGCCGTAGTTCACTTCCTTCCACACCAGCATCTGCTAGGCATatcacacacacacacaggTTAGAGCGGCTCCTACAGACCTT
GTTCCGGCCCCTGCTGCTCACCTTGCGGTCGGCCTTGCGCACGATCTGCGTGACGACGCCGAAAGAGCCTTTGCCGATGATGCGGACCTGCTCGTACGCG
TCCATGGTGGCTGTAGGCTGTCCTCTGTAGGCTGTAGGCCTTAGGAGGGGGGGGGAGAGGGGGGCACTCCGCGTAGACagaggagggggggggacTGGTA
ACGCGAGAGACCGAGTCGAGAGCGTGGCGATGGGAGGAGCGACTGTCTTGGGTCGATCCACACGCTGCCGAGTCTTCTCGCCTCTCCGCTGTTCTTCGGT
TTGTG