Description :
From Genome Similarity Track
Location :
Scaffold_2164:1293- 3069
Sequence
1776 bases(100 bases per row)
GCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAA
CTAACCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTT
GGCTTGCAGCTGGACCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATCG
ATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTT
CAGCAGGCTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAG
GTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCTTCCGTCTTCGTAGGATCCATCATTGGATCCGAACATCGCGGCCTTCTTTCG
CCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGATATCAGGAAGACAAACAGTTCGATCTAGTCGGTCCTCTAACAAGTTTAAGTCCGACGGTT
CTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGAGAAGCCTGGATCCACTCGTGGATCAGCGGGATCCGGCTGTTCGGC
TTTAGCCTTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAAGGCCGACTCTGGGGATCGTTCCCCGTCCTGGATCCAACCTCCATCGCTTGGACC
TCAATCCGACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGTCCCCGCCGGGAGCTCCACCTCTCCGA
GAAATTCAATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCAT
CGACCATGTTGGCATTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGTAAACTCATCCATTTGACGCA
AACTAAAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCGAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAA
TGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTATTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTC
TGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCAGACAATTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTA
GAAGCAATGATCTCCGGGATGACCTTTCTTGCCGCACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAA
CACCTGACTTGTGCTGTCCCGTCCATGAGATCTGGGGATCTGTACATCCCACGGTCCCCGGGTACGGTGTCCCCCGGTTGAGAGTTGTCTCCGGTCTTCG
CCGTCCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCCTCAGGGTCGGAGTCCGAACCGTCGGATCCTGA