Description :
From Genome Similarity Track
Location :
scaffold_16:129295- 131520
Transcript NameFunction/comments
Plaha_PHALS_01051hypothetical protein

Sequence
2225 bases(100 bases per row)
CTCTCAACGTCGTGGAcgtcttgtccaatacaaaTGCCGAGATTATTGTGCTCATATTCTGGACAAAGTCGACGAGTTCTATGACAAGAACGAGCAATCA
ACCCCGTTCATCTACGTGGGAGGGTCATCAGGCATGGGGAGATCGCAACGTGCATTTGCATTGGGTGACCGACGACCTTGGTATTACTGCCAGTTGGATC
CGGTTCTAAACGTCTCTATAGCAATTTTACCTCAATATCGAACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATTGGTAAGCACGAGATACGAAGAGTGAGCTTAACTGA
AATTTTTTGAATGATGCATGCGAACGAGTGAAATCACAAAAGATATTTATTATTGAATGAAAGCTGCACTGACGCTGGTCACTAATGCATGTCGCAACGA
TTAAACAATGAGCTAGAACGACAGCATAACAAAAAAGGTAATACACTCACTTTATCTAGTAAAATTAAAGTTTACGAGAAAAGTGACGAAGTGATGACCA
TTCCAGTGATGTCTAGAAATCTTTTTCAAGAAGGAAAATGTCAATATATCAAATCTTGTACCCAACGTGCTAAGTTGTAGATTTCTAGCATGCCACCTCT
AGACTACTCGTTTCTATGACGATGCAAACAAATCTGATAGATCCAATTCGTTGGCCGCCCTATTTTCACTGGTAAGGAACCAAAGTGCTAGCGTATTACT
TTAAGGTAACGGTAATGCTTGCGTTAAAGCTGGTACTTTCTACGTCAGGGCAGATGAACAAGATGATGCAGACCGCGGGCGAAATTTGGACGTTCACACG
GTGGGTGTGCGCACTTTGGTAAAGTAAAAGTCCCTCAGTCGGTGGTTATCGGAATTACAGAAAGAGTTCATGCATGGTATTTATCTCCCATCCCATCTTC
GTCCTGGTGGGTTTGGCTGTACAGTACTCCTAGCGACCTTTTTACGAGCGCTTGCTTACCATAAGAGAGAACATCTGTCAAATTCCCTAAGTCACCATAC
ACTTCACCTTGCGAAACGCTAATCGGTTTAGTGAGGTCGCAGCGAGATCCATTGTTTAGCTATCTGGATTGGGCCAAAGTGTTTCTTTCGTAAGCTCTGC
TTTTAAACATTTCGCTATACAGGAC