Description :
From Genome Similarity Track
Location :
Scaffold_68:129280- 131080
Transcript NameFunction/comments
Phyca_LT153459174AlNc14C25G2469

Sequence
1800 bases(100 bases per row)
tcagcaggaacttgagcggtacaagtcgacggaggtcgcttttgtgcgagcggaagagcggaaacgttttgatagagaaattgataatctccgatcatct
ctcctacaagagtatcgcaataagcaggagcgtcttcaggagcgtgaacgtgatttggaacttgctttcgtcggccgacgaactgagttggaaacatcgc
tgtttgaaactaggcagtcgctgttcaaagatatggagaggctgcgagtgaaggaggccgaactccaagtgaaagtagaaagtgacttccgtcactttgc
tactgagacacagcgccttcaattgtgggaagaaagcgtgcggactcaagaagcgaatctagagagcattgtagcccaagcgatgagagagaaagagcgg
gcgtggaatcttgagcgccagcaagctcttaaagatattcaaatcaagcaagatgatctcatcgagcgtgagcgattacttactacggagacaggaacgc
tgaaagcgttaacgatgcaagttaatgctctacaacaagaaattgctgctctggaagctgcttcatcggtaaggcctacgagtatttcaggtgacactcc
tgtcaattcttacgcttttatttgttcacagaaatcggggaacgatctccgaaaggctgaaaatgctggaattcagctggaaagggatcggcaactactt
gaagaacgcgtagctgaactggaacagcaacttggtgaacaaaagagtagcctccttgatgctaccgccgccaatgctcgccttactgccgatagaagta
tggctgctgacgaactatcccgctacaagcagaagagctcagaagccaaggaacagcacaaaatcctcactgctgagattaaagcacttcaccagcagat
tctggacatgaagtttgaagaggcaaatgcggttgtagccgagcggaagaagtttatgcaagttctggatgaggaacgcgatcgttcgaactggaaagag
aacgagctgctggcaaaggttcgagagttgcagagtcgcttggctgagtctgaggccctggcggaaaagtatcaaagccaatacgaggacgagaaggttc
acgttgagtcactacggcatgacgtttcaagtttgaactctcttctgactcaagctcaagcaacaataaacgccaagcatggatctccgagggatttcgt
gaattttagggcgacgcgtggagcaggacgtcatgattctgccgaaagtgactatcaggtgtcttctgactaccagccacgaggaagcgaacgcactttc
atgatgaagatgatggaaatgatgacaaattttcaagacgaacgtaccttacagcgtgacgatagtcgccgagaacgagccgagacatctcaaagtgtgc
cttctatagtggaccggcaagctcaactaactagaccgttgccaacttcccaggcttttgatgaagaccaagacgataaacggctcaaggaagatcaggc
acgcatcgaacgggacctcatcgagcagcgcgaatacgaaaagaaaaaacaagctcgaatggaggagcaagaacgggagatggctgagcagaatagacaa
tttgagaagaagcttgctcgcatgcgtcaggaacgggttgaagaggaagagcgacttgaagagcagcggaaacgcaggcagaaggaagaagaagcgaagt
tgcaagaagagttggagagacagcgtgctgcagtgcaagaagctgcagagctgcagcaacagctcactgagcagcgcttggcggacgaacagcagcgtct