Description :
From Genome Similarity Track
Location :
Scaffold_23:12923- 15032
Transcript NameFunction/comments
Phyta_totarag1277hypothetical protein PHYSODRAFT_298516

Sequence
2109 bases(100 bases per row)
ACAATAGCATCGTTCGCCATCGCAACGCCACCTTgctcgtcatcttcctcgaATTCTTGCGGATCTTTAATCAGCTCTTTCAAAACGGCAACGGAATCAT
CAAAAACTGTGTTTTGACTGTCCTCTTTTGCCGTCACACTGGATTGTTCGATGCCGTTCATGAGAGCTTGCAAAAACTTCAGACCAGTCGAGGTCGATTC
CACAGCATACAACGCCACAAACGAGACTTTCCAGGCAGCATGCGCGATGAGAAGACGGATGATTCGAATGCCCATGACCAGTCGGCTGGGCTGGGAAACG
ATGAATTCCGTCACGACAGTCACGAGATTTGTTACTTGGTCCTCTCCCATGGAAGCAATGCGTGAAGACGCCATTTTCAGTACCAGGtacaagagctgca
agagcgCCTTGttcagctgcatctccaCAGAAGTAAGCTCGTCTGCAGATACGTCCATCCACCGGCGCAATCCCATCCAGAACGCACGCAGCATCTCTTG
GTCAAGCATACGTGCAACAAGTTCCTCCCCGCCGCCAACAGCACAGCTGAGGcacttgatggcgttgcttCGCATATCACTGTCGCCCGTAGAGCACGCG
ATTGTCATTAGAACAGGGAAATACGCCACGCCAACAACACGTTCCTGAAGTTTCTGCACCATTTCACCAATCTCGAGGGTCGGGGGATCCTCCAGGGTAT
CCAACACATCAGCAATAGACTTGACACCGCTCAAGCGGGCAAGCACATCCAAACTACCAGCCTTTAGCACCTCGTCTCGCCCAGACGCCATAAGGAAGAG
CGTATCAAGCACGCCAACCGAGAACGGGCGCTTGTTTTCAACGAGTGCCCGGAAGTAACGGAGAGCTGATAACCGGTTTTCGTCAGGAGGCGTCTGCAGT
AGTCGATGGAAGAAGTCTGACACATTTCGGTCATAGAGCTCATCGAAGATGCTAGGGTTGAACTCGCAAAGGTTCATCAAAGTTTGCGCGCATAGCGGAA
TCAGACGCTCCTTGCGAGAAAGCAAGAAGGCGGACAACGTGGGCACGCAGTTGCGCGAACAAATGTAGTCCACATATGCCGCCGACTCGGCGCTATAGCT
CATCGTAATTCCAAGCAAATTTCTTTGGAACGTGATCTCAcccacgagctgcttctcgccaATCACGCacgcgttcagcttcttcagcaccaaATCAAAC
ACTTCCAGGTCGTAAATGACCTTCAGCACCTGCTCGTGCGCATCATCGACTTTTTCACCGGGAACAGTATCGCTGAGAGACTGCTTAGGCATCGTCGAGC
AGAGTCCGCACAAGATCTCCGAGGCGACAGTGTAGTCTTCATCGCTGTCCAGCATCCACATGATTTCCTTGATGAAATCCTGTTCCTTCGCCAAGATAGT
GATCAACGATGGCTCCTTTGATACCTGAATCAGAACTTGCGACGCTAGCATGCGGTTCACGCGGTCACCTTTTTGTAGGACAGTCACAAATGAGTGGATG
CTGTCCGCAGGGATCTGCTGCACACCGCGCTGCACTTGCGAAGCACCATTATCCGCAAAATGGATACATTCGCAGATCGTGCTCAGAATGGCCTCGATGG
CAACTTCATGCGACTCGTCACGTGGCACTTCAATGCCGCTGTTTCCAAGGGTGCTACCCGTACGCAGCTCGATGAAATCTCCCAGCAAAGTACACAACGA
TGCCACACCCTTGTTTTGAGTCATCTCGGTGATGTTCTCAGTATTCTTTTGCACAAAACGCTTCAggcaacgtgctgcttccactcgcatttccagcgac
gacggtgagTCAACAGAAAGAAACTCCAGCAAGCGTGTACCTCCACCCGTCTTGCGTAATGCAGCCTGACACGTAGTCGACTGGCAAATGTGGTAAACAA
GACGAAGGGCCATGCGCTCCACCTCGGGGCGAACGCTGCGgcccagctgctgctccataACCCGGTTACCCATGACCTTTACCAGTTGCGCGCACGCTCC
CGACTGCGCGAAGGCCTCGCCGGTCGAGAGTTCGTTACCAGCACTATTCTCGAGCTCAACGAGAttcgccagcatctccagcgcaGCTTGCTGTAGAGGC
TGCACATCG