Description :
From Genome Similarity Track
Location :
Scaffold_949:1292- 3506
Transcript NameFunction/comments
Phyag_g8830hypothetical protein PHYSODRAFT_347554

Sequence
2214 bases(100 bases per row)
ACCAACGGAACTTCTGGGGTCGTAATAGCCGAGCCCAACGCCGTTGCCCGTGCGACCGCCAGAAGACACAGCTCCACCCTTCGTGCGCGACTCGGTGCCG
AAGGAGTACGATGCTGCCGATGAGAGCGTCGATACGGCTTGGCGACCAACCGCCTCGACAACGACCGAGTACTGGCCAGGTCCTACGTCCGCCGTGCTGG
ATGTGCGAAGCGGCTTGCGCTCTACCTTTGGAAAGGACGACATCGGGTTGGACTTTTGCGTCGATAGAACGGTACGCCCGATGGTTGGAGTCGTCTCGTA
AGCTCCAGGACCAGGGAACTTTTTCTGACCTGCCATCGGAGACCACTTCTTGCCAAGAGAGTAGCTGGGGGCCGCTCGCTCGCGTGGGTTGACGATGTTT
GTGTTGTAGTCACCAGGTCCTGGGAATTTGGCTGAGGTCTGGAGGTCAGCAGTGGAACCGAACTTTTCACGCCCGCTGATGGAGCATGACGGAGCCTGTT
GCATCGTGGAGAGCACCGGCTTGCCGATCGACGACGGGATCTGGTACTGGCCGGGACCTGGAGATTTGGCGCCACTTGTCGTGCGGGGGCGAGTTCCGCT
GCCGAATACTGTGTAAGGTGCGGTGACCTTACGCGAGTCCACTTGTTCGCCGACGGAAGACTTGACATCCATATACGTCTGGTGCATCGGGCTCAGCGGG
GCCTTTGAGGGCGACTTGCCCGGAGAAGTCTGAGCACGGGGAGGTGACGAGGCCATTGTTGCTCTCTTTTGTCCTAGTGGTGGAAGAAGGACTTACGAAT
GCCGAAGTGAGTGCAACGAGGCTCGCCGTGCTCTTCTGGTTGTGTTCGCACAGAGCAGATCGGGATGTGGGTGTGCCAAGTATGGAGGCTGTCACCAGTT
CTTCGTTGGAAGTCTAGGCGCTCCAAATAGGTCAGACGGCCGAGGAAAGCAGCAAGACGGCCAGAAGGAGGATTAGCTGGTAGCACCACGAAAAAGAAAG
CGAGGCTTCCAATGATGCGGTTGAGTGCTATTCATGGCGATCCCCCTGTCGAGCTTATCCACACAAGGACGAGCATGGTTGCCTCGAAATAGCCAAAGAC
TGGAGACAAAGGTTCGAGCCGCGACGCTCACGaacgtgttcgtgctgctgcaagacaACGACAAGAGCTCTGGTGCAATGGAGCCCAAAAGCCCGGATGG
CCAACCAAAATGAAAAATGGCAGAACCACCGGaatgacggagctgctgacgtacGCGATAATCATTCGAGAGAATGATGGTATCGTAAAACGCAAACATG
ACTTACCACCACACATTCTCCGATGGAGATATCTCCGTAAAGTATGCCAATTCCTGCTGACCCCAAGCTGCGGCTGCGTTGCTGGACGCAATTCGCCCGC
CTCAGGACAGAAAGTATAGGATTGCTGGGCAGCtacaattgctgctgtggagtgCTCGATTTTGGTTTAAATGGACGAAAAAGGTATCTTTGATCTTTTT
GGAAAGGGCAGACAACGGTCTCAGTAACGGTCGCGATCTTGTGTTTTTTGGATGCTAAAAGTACAAATCAGTCCTTTTCCTGTACTGACACAAGACGGCG
CTATCAGGATGGGCTTTTGGATTCTTGCAATTGGCTCGAAGACGCGCAGTGGCGCGTGGCTACTGCGGCTCATGGCAATCGACCTCGCCGTGCGCAACCA
TTACATGAAGCAACATTCATGCTCCGTGCTGTACTTCTCTCTGGTGTTGGAATGATTCAAATCACCCTAGGTCCTGCCTGCAGTTAAGGCACGCGCATTG
GTGGGTGAACCTCTCCTCGGTTCCTTGTGAATAAGCATAAGCAGCAAGATACAAGTCGAGCGGCAACGCTGAACGTTTCTGCTCATAGCAGCGgaatgtg
gcgctggacatcCGCCCACTTCTTATTCAGGTCCGCCCTTGCATCTGTCACTCTGCTCCACCAATTCCTCTTCCCGGCGTTGCGGCGTTGCATGGCGAAG
AAATGCGCCATCGATTCAATGTATCGAAGGTTCATGCACAGCTCGACTTACTGACCCGGACCCATGAATCCAGACAGAGCCAATGTCACTCCAGTTCTTG
GCAAAAACTTGAGCTGAACAACGATGAGTGACTTGAGCCCAAAACACCAGCAAAACTCTTGTCTCCAGCCAGCATCCTGCCTTCGTTGGAGCCTTCAGCC
GCTCCTTCATTCCC