Description :
From Genome Similarity Track
Location :
Scaffold_1702:1292- 2996
Sequence
1704 bases(100 bases per row)
CCCAAGTCGGCTCATCGTATCCTTGCCACTGGACGTAGAACTCTCGCTGGGTCCGCTCCGTGCCTGTCGAAATTGGCCATCGGTCGTCGAGGATAGCTTC
GACGATGTACTTGTCACCGTCTCCTTCCGGCTCCCAGCTGTCCTCCGGCAGAAGTTCCTCATCGAAATCAAACCTCTCATCCTCGCCGAGTCCGTCGATC
AGCTCTGCAGTCGGTCTGCGGTCATCTTCGCTCACTGCCTTGAGTCTGGACACGTGCACCACAGGATGGAAGCGGTAACCGGCCTTGTCAGGTAGTTCTA
GCTCGTAGGCAAACTCCTCCACCTCCCGCTTGATGCGGAAAGGGCCATGCCACCTGTGAGCGAGCTTCTTGGTCAAGCCGGGCTTCACGCGCTCCATAAA
CAACCATACCCGGCTTCCTGGCTGGAACAGTGAGCGATGGACTGGTTTTCCTGTTGATTCGTCGACCGTTGCTTTGCCAGGATCGCCACGTTCGTCGAGC
GGTACAGCAAGCCTTTCGATTCTTCCTAGGACTTCGTTGTGTTCTTTCGCTCGCCGAGCCTTTTCGGTGGCTTGGTAGTGTTTCGCCATTGCCAGAGCAA
TTTCGTGTTGTCGGTTGGCCTCGCGTCTCCAGGCTGCATCGTCCGTCTGATCACCATCGCCGAGCCTCAACGAGCTTGTCATTGCCTTGAGTGTCGATTG
GGCATCCCATCCGTGGGCGAGGAAGAATGGTGTCTCCTTCCTCGTTGTGTCCATCGAATTATTGATCGCGTACACCATCTTCTCAGCGATCTCGTCCCAG
TCCTGCTGGAGTGGGTCTTCGACGTACACGTTCACGGCTTGGATCACCGACTTGACAGACCGCTCCTGCTGACCGTTCGCTTGGGGCCGGTAGCTGAGCG
TCGCTCTAGACCTCGACTGGATCAGCTCGAAGAATGCCTTGAAGGTCTCACTCATAAAGCGTGGATCGCGATCGTGTCGTGGGCACCAAAGCGTCGGAAC
ACATATTCCTCGAAAACATCTGCAACGTCTTGTGCCTTGGTGCTGCTCATGGCTTTGGCGATAACGTAGCCAGTGAAGGAACACTGGAACAGCAACATAG
ACGTGTTGCCTCGCCGAGTCTTCGGCAGCGGCGTCACCAAGTCCATCGATACCAGCTGGAACGGGCGGTCGGCGAGCACATTGCCCGGCGACTACCCCTT
CAATTGGGGTTTGCCCTTGCTGGTACTGCAGTCTGCGCATGCGCACACATGGCGAGCCACCGTGGCGTACAGTCCAATCCAGTAGTAATCTTTCTTGACC
TGGTGGAACGTGCGCGTTATCCCTTGATGCCCTCCTTCGATCGAGTCGTGACAACTCTGCAGGACTTCTTCAATCATCGTCGTCGGTATCACCAGTCTCA
GCTGAGGTTCCGGCTCGCCACCCTCGTCGAGCTTGCGTCCCTTACCCACATAGTGTCATAGTGTGGCACGTCGTCTCCGTCCAGGACGAATCGGTCGGCG
AGTTTGCTCGCATTGGCTGCCCTTTTGAAGTCGAGGGACTCAATGTCACCCCGGAGGTACGGCCCACCTCCTTTCTTCGTCTTGGGCAATGCAGACTCGC
CGTATGCGTTCTGCTTGCACCGCTACCGGGTCTGGTTGCTCGTCAACTTCTTCAGGAGTAGCAGGAGCTGGTCCGTTGGTGACGATGTCGTCGTTTGCAT
CTTG