Description :
From Genome Similarity Track
Location :
Scaffold_4:1291966- 1304408
Transcript NameFunction/comments
Phyin_T30-4PITG_03284Putative uncharacterized protein
Phyin_T30-4PITG_03285Putative uncharacterized protein
Phyin_T30-4PITG_03286Putative uncharacterized protein
Phyin_T30-4PITG_03287Putative uncharacterized protein
Phyin_T30-4PITG_03288Myosin-like protein
Phyin_T30-4PITG_03289Myosin-like protein

Sequence
12442 bases(100 bases per row)
GGTAAGCTCGACGACGCAGTTGGCCTGTGTGGCTGACCGCTCGCCGGTTATGGTGACTCTAAGCTTTGACACTGTCATTGACAGGACCATTGCAGACAAA
ACATATCTGTGCCCGTGTATCGTCGTAAAAATCCGCCCAACACTGCTGCATGTTCTGGTTGCCAATAGCTTGTGGGTGCGTGGATCGCAATAATGGTGCT
TAAGACCCGTACTGATGCTAACACGACCAAAATCTTTCAGTGTGTGGTCAGGTCCGAAGTTCCAATCACAGACGTCGCGGACTACGGCAGCCATCACTCG
GAAGACGGTGAAGCTCGCCAGAAGATCCTCGTATCTGCCGCAGACGGAAACGTGTGGGTGGTGACTTTGCCTAGTCATTTGCAACCTATAGTGCGGACGG
TGACACGCGAGTTGCTGCTAGAACGCTCGTCCAGTAATAGTGATGATGGAACGGTGCAATGGTTCTGCCAACTGCCTGGGGTGCAGTCCGTGGATCACAG
TCCAGCAGGATCGGGGCAGTCGTCGCTTACACTGATGAGGAGCTTGGTGACGCCGTCCACTCTGATTGTAAGTACTCACAGGAGATCTGAGTCAACACTG
CAGTCCCACCAGTCGCTGGAGCTGGATGAGATCGAAGGAGAACAGTCTACTTGCACATTTTGTTTGATTAGTCAGGTGACAAGTCATCGTGGGCTGTTGA
GGGGGTTGTTTCCGGATGTGGTGATCAACGCGGGTGTGGTAGCTATTTTACAGGGAGATCTAGATGGTTCTGTGCGATTTATATTGGTACACTATCCGAA
CACGAAAGGAGATGGCACGAAGGCGTCTGTGGTTCGCAGCGGGAAACTACTCCGGTTGTGTGAACCGGTTCAGATGATCGTCCCGTTCTCATCATCAGTG
CCACCTACGCACTCCTCGGAAGGAGAGAAGGAGAATGCTTCAACGGATATGTTTGATGCGCTGCTAGTGCTGGGAGCTCGAGGCAAGATTGGGGTTGTTG
AATTGAAGAATAGTTGCTCGATGGAGCGCCTTCCTGTTTCAATTACAAGGCTGGAGCTTGGAAGCGCAGTGCAGTCGCTGGTTTTCATACGCAAGTTGGC
AGTATTTGTATTCTGCTCGAGGGGTTCAGCGTTTGTGTGTCGAGGCGCCGATATACTTGCGAAATCTCACTTCGTAGAGTCAGAAGCAACCACTACTGTC
AGGAATGGTTTTATTGTGTCTTCAGAGAAGCTACCTTTTCGACCGGTACGTGCCATCTACCTCACTGAGTTGAAACATGTGGTAACATGCCATACGTGAG
ATTTAGGGCATCATGCGGTTAGCAAGTCATGGCAGTGCAGGTGGTCTGTCGATTCTCTTCGCGTCAGGACGGATCGCAACTCTCGATAAGACAGCACTTC
ACACGACGGTAGCCAGCGTACTACCATTACTTGGACAAAAACCAAACTCAAGATGTGATGAGCAACCTGCTACAGGAGAATCAGCGAGTGAGTCTCGCGT
TCGCAATATTTTGCATCGGATTGCTCAGATTTCCTCCCAGTCAAACGCTCTGCGCACCAAATCGAAGCAAATGGACTTTCAGCTCAAGACCTTGTATTCT
GCTTTAGAAATGCTTCGAATAATTGAAGCTGCAGGTATGTAGGATCGGAGGTGATATTGTCTTGTGTGTGTCTCAACCGATGTCGTCCTTGCAGGTGTGG
AGTCTGTGGTCAAATGCGACTTGAGAGCCTCGATGGTAATGACTGGAACGTTTTCGGATCGACAAACGGTTCAAATGGATTGCTCATTTTGTTTCGTGAA
TTCCGAAGCTATCATCTCACTTGACGACTGGTAGGTGGTTGTAATTGTTCATCATTCATTCACATGAACGTTCCTTACGAATCGCTAATTCGCGTAGGTG
GTTGTGTCTGTACGTCCGTACTCATCAGCGTGCGGCCACAGCGTACTCATTTCCGCTCATGGATATCGCAGCGAGTGGGAAACAAAGTATCATCCTCGAC
CCAGATGCACTCACACATCAAGATCAGGGGGCTGTGTGGGTCTCATGCTCAATGACGTTTTGCCCTTCACTGCGTGAAACTTCCGAAAGTGAACGACCCC
ATTCGAATATCGAAGCACACGTTATTAATCAGGATGATCCATTGTCGTTCGCAATCCCGCTGTTTCAAGACAGAAGGTTCCTGTTCGTACAGCTGAGCCA
GCCCATTGAGGAAGAGATTCCTGCTAGCCAAGCTGCTATCCACGCTGCTTTCCGTCAAAAGCAGGAGCCGTTCATGCCAGTGGGTAGAGCCACCAAAGAA
GGAAAAGCGTGTTCGTCTGTTCTCTGGAGTGGTGTGCAATGGTGGGCTGCACTAGCTGACCATGCGCAGAGAAATCCTGCGTTCGAAGCTTTATGGTCAA
AAATTGCGCCTTCAGATGCAGCACCTCTGGCCATAACTCCGCCATCTCGGTTTGTTATATCCATCCCTGCGTTCTTTGCCACCGAGTACGACGACGAAGA
TGACGAAGATGAGGATGAAGATTATGAAAAGGTTCGAGTCGAAAGGATGGCATCATTCCTGCGTCAGCTCCTGGAGATACCCAGCGACGAGGTTCCAAGA
TTGCGCCGTAGCTGCCGAACACAGCACGGGAAACTCTGGACGGTACTACGAGCCTTCTCTGGGAGTCTCATCCTCCTTCGTTTCACGCCGTCTGAAGACC
AACAACGATCAGTTGAGCTTGCTATTCAGTGCTCCGACGTGGCCGACCTCTCCGCGGTAAGCATTTACCATTAGTCTAAACTCATTCTGGTGATACTTAC
GCTATCATACTGTACAGATGCGAGCTCTTGTGCTGGAGACGATCAACAAATGGAGTGAAGGAGGCTTTCGAGAAACTAACGAAGAAGTCCGCTCTGATGA
GCTAGCGCTGGATTTTAGTGAGATGCTAGAACCTATTGCGGCTCTTGAGAATGATCTGGAGGTCTGTAGCTTATTGAGTGGCACTGGTGGCAGTTTATTA
ATTTTGCTTGTGTTGAGTCGTCTCCCAGGATCTGACTTTGAAGATTAAACATATAGAAGACTCAAACTCGTTTTGCTGTACGGATGAAGTTCTCCATGCG
CTCTCGAAGCTGGCGCATCTGGAGACTCAAACTCTTACGCTATACTGGAAGACAAGATTGCATCTCAACAGGACCATCATGTAGAAAGTTGTTCATGATT
TTGACGCGACAAGAACGATTAAAAAACTATTAGCCGCGTCAAATTAAAGAATGCGGCTTCCGTCGCAGTGATGCACTTTGGTTTATAGTTCTTCTGTGGG
AAGATGCTGGTCACGCAACGACGCTTTCTCGGATGGTGACGACACGGAGTAGAGGCGCTACACAATATATAACGCATACGAAACTCAGCGATCTTGGCAG
TATCATCGACGTCTAGTGCAGGTTTTCGTACCTCAAAGTAGCGTGGAGCTCGAGTCGGCCACAGCGTGTAGATGAGAGACAAATAGATGAAGCAGTGCAC
TGAGGTCGTCATGGCGGACACTGTCTTCTCACGTACCCACGGCGACAAAAAAGAAGCGACGAGCACGATGATAGGTAGCGCTACAAAATACACGGAGAAC
AAGCCACACATCTGAAAAGGTATGGGTGAGAACAGGAGTTCGAAAGCAAGTACTACTGGTTCCGGTACTTACTCGCAAGAAGAAATATCGCTTTGCCGAC
GCTTGCTCATAGGAGCGTGTTTCCAAAATGGTGTTGATAAACCACCCTAGCACGCACACTTGCAGCACGCAGATGCCAAGTCCCGGCCACGAGTCATAGA
TGTACAGTGTCGACGCTGGGTCGAGCCATACAAGATACCACATTGCCATGGACAGATACAGCACCAGAGTCGCCAGTATAAGACAAGAAAGCTTGATCTG
GCCGTCCAGTGCCACGCTGTTGATAGTCCATCCTTTAGCGATCACCATGGCCAATAGTAAAGTGCCGACATGGACAAAGACCTCGGTAATCTTAGCCGCG
TATTTAAAAAATGGCACCCCCAGACCATTAAACTCGTATGTGGTGAAGTGAATGAAGAGCAGCGCGTTGCACAGGAAGAAGAACAGCACTACTAGTGTCA
AGATGCGCATGATTGGATGGAATGACTCGCTTTGTCTCATGCGTTGCACCGCCACAATTTGCGCTGCCGCTGCAGCCCCAGCCACTGCCGTCATAACGGC
GTAGATAGTCGGCAGTCCTTGCTGTTGCACGGGAAGCTCACTTCCATCTCCCTGCGTCATGTGGATCCTGAACCATGAGGAGAAGTAGTATTTGCGGAAG
TTGGTCTCTGTAATCTCTGCGAAGGCGGGTTTGTACTCGTCTCCCCCCGGTACGCACCGCGCAAGCGCCACATACCAAAATCTCGGTCGTAGGTGCTCAT
GGATATCTACGCTGAAGACGAACGGGGTCACGTGGTGACTATTAGTCGCAGTCACGTTATAGACGCCCTTGGTGTGTTGGGCAGAGACCTTGCAATTGCA
GTCGCAAGAGCTGTCGGTCATGACGTAGTTCCAGAAGAGCGCTTCGTCGTCATAGATTGCGACCTGCAGTCCATCCACGTCCGTCTCGATCTCGCCCGTG
ATTCGCTTGTAGTAATATAAGAGAGGATTAGATTAAGCCTAGAAAAAATGGGAGATTCCACTAGGTTTTAGTCATACCCCGGCAACGTCGTTGAGTGTGG
GCGTCCAGGAGAAGCAGAACTTGCCGATGTACTGGAGCTGCCGCCCCACGGTGTACCCCGCAATGATGCTGGCTCGGGACGCGGGCACCAGCGCCTCTAG
GCTGAGTAGTAGCAACAGGAATCGCATCGTTCTTCTCGACCCAAATAATCTGACGATCTTCTATCGAAGCAACTTCAAGAAGGCGTTTGATTGGCTGATG
ACAAAAGCTGAACCGTTTTCGGTGTAGCCATGTTGCACCGCAACTGTTGCATTAATTTGTCTTGACTCAAGTTTCATCATGCGTCTCGCTTTCAAGACCA
GCATAGGTGTGCTCTAGTGAGGCCTTTGCCAGCGCCACATGCATAATTTCTGGGTGGCGCTGCCGGATAGGATCAGAGAAAGCAGACAAGACGTGGGTTC
GTGTTAGTTGGCATCATTAGTTGGTATTTGTCATAGAACACAAAGTTTGTGGCAGCGGCGAAGATGGGGCCCTGAGGTAAGTAAAGTTGCTGTTTACAGG
CCGGAGGTTTCCGCGTCCGCTGCTGGAAGAAATTATGTCATCTTGCTAGCTCGGCAGGCTTTGCAGCCGTCAATATTATCGGGAGCAAGGGCTAGTTTTC
TTTGAAGTCATTGAAGTAACGGGTACCAGCACCTTCGCGGTGTAAAAGTTGCGTTAGCGGAAACTAACTATCCATTCGACAGATGCGCTATCCAGCAAGG
TAGCTTCGCGTGTTCATGTAAGTACATGAAGGTATGTGTGTGGCTTCAGCTCGCTGCCAGCGCACGGATATGTATTTAGCAACGTGAGTGTGTGTCGGTG
GCATGAAGCGTCAAGGCTCGTCGCCTTATCGTCGGTCTCAGAGTCTTTCCCAGCATCTGTTTTCGAGGCTCTTCAGTAAGTGGTAAAAGAGTTCGGAAGG
GGAAGGGGACGTTCATTCTCAAGGCAACTCCCGATTGGCAGCAATTGCAGGAGTCAGTTTCCGTTAGGTCCAGCGCTAAGTGAAGCAAGTCTTGCAGCGT
CGAGTCGTGTCGGAAAATCTCGTCGTCGCGTATCGAGAGGCACACTGTCCAGAAGCCGCTCATATCGCGAACTTGCGCGCTACTACGAGAGGCCAAAGGA
GACCAGCGAGGCTCTTCCTCTTCGTCTTATTCTCTCCCACGGGCTCCAGCTATTAGACACCGACGCCATCTAGTCAAGTTTTGGTTTCTTTTGCAGCATG
ACGGTGCGTCGCACGGAGGAGCTGCAGGAGTGGATCTGTAGCGTCACAGCCACAGCCAACGACCATGGCGAGCACCTTTCGGTGATGCTGCGCGACGGCC
AGTTGCTGTGTCTGCTCGCCAACGGCGTGGACCCGACTGCGAATCTCAAGGTGAACAAGCTCAACACAGTTTTCCACTCAAAGGCCAACCTGCGCCTCTT
CCTCGAGTGGTGCAAGAAGCAGGGTCTGAATGAGGGCGAGATTTTTCAACCAGACGACCTGCTGGACGCCGACGCGGACTTCAGTACTGTGCTTGAGACG
CTCTCTATACTCTTCGACAGGTTTGGCACTATCGGCTACACGGGCGAATACGAAGAGGACCCAGTGTCTGATGCAGAGTCTATGACGTCCACAGGCAGCT
CGCAGGGAACGTCGCCCGTCAAGAAAACGAACAGCAACAACAAACTTACGAGTTTCATGAAAGGAGGCTTTTTATCAAGAAAAAAGAAGTCAAGCAAGAA
AGTGGTGGACAAATCCCCCGAGAGAACTCCCCCGTCGACGCCTCCACCAATGTCACCGCAGGTTGGAGGGGGAATGATGTCTCCGTCGGGCTCCCCGCCT
TCGACGCCACCTCCGAAGGACACAAGGAGCAACAGTGGAGGTGCCAACGCCAACCGGTTGAACGCCTTCTTAAACCAAGTGCCCGCGTCACACGCGTCCC
CGTTGACACATGCTGAGCGTCCGTCAGGTCCGCCCAAGAAGGCCAACACGGCGAGGAAGCCACCGGCACCAAAGCAGCCAACTGTCAGGAGACCGCCGTC
ACCCAAGCAGCCTCCCAAGTCGCAGCCTACTGTCGGTGACACCCGCAACAAGTTCGCGGCCTTTATGAAGTCCAACCCGCCTGCTGTCGAGACGACACCA
GCCTCGGGCTCGTACACCGGGTCTGCAGGCAACAAACCACCTTCCCCACCCAAGTCTGCCCCTGTCCGAGGTCGTGACACGTCAAGCGACCAGTTCGCCC
AACGTAAGGCGGTCTTCACTCAAGGCAATAGCAGTCCGAAGCCAGACAAGCCCGCACCTGCTCCGTCGAAGCCAACTGTCAGCACAGGAGGTGGGAACAA
GCTTAACAACTTCATGAAGCAGCAACCGTCTGCTTCACCTGCTTCCTCGACGAAACCTCGTTCGCAGAGCAAGCTGGCGGCTTTCCTGGCGACGACGAAC
TCGGTTCCTTCTCTTGCGACGACACCTTCTGCCGCGCCACCAAAGCCGACGTTTGGTTCGTTCAACCCAACTAAGAACGCTCCGGCTGGTGGTCGATCAG
CTCCCAAGTCAACGCACAGCGCCCCTACTCCTGCAGCACCGACGCCGTTCAAGCCACGTCACATGATAGAGCGCTCCACAGGTCGTGGCAACTACGTGCG
TAAGCGTCAGACGTCCTGGGTGCCTCCTAAGCGTCGACGCAGCAACTTCAGCTTGGAGAAGAAGCGAAAGTCGTTCATGCAAGAGCAGTTGGAGATTAAG
GAGGAACAACTCCGTCAGCAGGCTGCAGGTGCCAGCAACAAGCAGAATTTGATCGTGCCAGGTGTGCAATGCTACATTCCTGACAAGGAGGAAGTGTGGC
TGCTCTCCGAGATTGTGAACTACAACGATCGTCGAAAAGAAGTTACGATAACGGCTTTCTTGGACTCGGGTGATTCAGAGCAGCGCGTTGTGGATCTCAA
GAACCCGGACGTCATTCGCGCGGTTGCTGGCCCGACAGCCACCGAGGTGGAGTCACTGCCGGTTGCAATTCTTCACGATAACCCGGAAGGTGTGGAGGAC
ATGCGTCTGCTCCGATACTTGAACGAACCTTCGATTTTGTTCAACTTGAAGCAGCGTTTCGCCGCCTCCAAGCCTTACACGTACACTAACGACATTGTGA
TCGCTGTCAACCCGTACAAGTGGATCGATAACCTCTACGGTGACCATCTGCATGAGCAGTACCTGAAGAAGCCGCGCGACTCGCTGCCTCCACACGTGTA
CTCAACGTCGACTGCTGCCTACAACCACATGAAGACGAACGAAATTAACCAGAGCATTCTGGTAAGTGGAGAGTCAGGTGCCGGTAAGACCGAAACGACC
AAGATTGTGATGAACCACTTGGCCAGTGTGGCTGGTGGTCGCAAGGACAAGACTATTGCAAAGGTCATTGACGTGAACCCTCTGTTGGAGTCTTTCGGTA
ACGCCAAGACGACACGGAATGACAACAGCTCGCGTTTTGGTAAATTCACGCAGCTCCAGTTCGACGGTCGAGGAAAACTGATCGGTGCTAAGTGCGAAAC
GTACTTGTTGGAGAAATCGCGTGTGGTGTCGATCGCCGAGGGAGAGCGCAACTACCACATTTTCTATCAGCTTCTGGCGGGTCTGCCCAGTCGCGAGCGC
AAGGAATTTGGTCTGGATCCTGACTGTCAATACCAATACGCTGGTTCTCTTGCGGAGATGCAGATCCCTGGTCTGGATGACGCGAAGTGGTTTGCAAGCA
CGCAGAAGTCGCTGTCCATCATTGGACTGGACGGTAGTGCACAAAAGACGCTGTTCAAGATCCTGGCGGGTGTGCTGCTGCTTGGTGAGGTCATGTTCGA
CAAGAGTGGGGAGAACGGATCGCGCATTTCAAGCGGTTCGGCGCTGTCCCAGGTAGCTAAGATGTTCGGTCTCCCTACGACCAGAATCGAGGAAGCACTT
TGCAACCGTACAGTTATCACTCGCAACGACAGTGTGACGGTGCCGTTGGCTCCTGTGGAGGCAGCTGAGAACCGTGATGCGCTGGCTAAGACGATTTACT
CCAAATTGTTCGACTGGATGGTGGTGAAGATCAACGCTGCTATTAGCACGGACGAGAGTCGCATCAAGGGCCAGATCGGTGTGCTGGATATCTTTGGTTT
TGAGGATTTCGTCCACAATGGCTTTGAACAGTTCTGCATCAACTACGCGAACGAGAAGTTGCAGCAGAAGTTCACCACCGATGTGTTCAAGACTGTGGAG
GACGAGTACATCCGCGAAGGGTTGCAGTGGGATCACATTAAGTACCAGGACAACCAGGGCATTGTCGAAGTGATTGAAGGTAAGATGGGTATCATTGCTC
TGATGAACGATCATCTTCGTCAGCCTCGTGACACGGAAGAAGCTCTGGTAAACAAGATACGCACGAACCACCAGACCAAGAAGGGCGGCGGCGTGAACGA
GAGTATCGACTTCCCCAAGGTCAAGCGTACGCAGTTCATCATTAACCACTACGCTGGCCCCGTCACGTACGAGACTGTGGGATTCATGGAGAAACACCGC
GATACACTACAGAAGGACCTGCTTGATTTGATCCAGCTCAGTAGTCTGTCACTGCTTCCAGAGCTCTTTGAAGACGCTGAGGCAACGTCGGAGGGCGTCA
GTGGACGTGGCAAGAAGGCTCCGAAGAGTCTTGGCTCTCAGTTTAAGACATCACTGACGCAGTTGATGGACAACATCAAGACCACCAACTCGCACTACGT
ACGTTGCATCAAACCCAACTCGAACAAGAGTCCGACAGAGTTCAACAAGCGCATGATCGTGGAGCAATTGCGATCGGCCGGCGTGATCGAAGCCATTCGT
ATCACACGCTCTGGATACCCGAGTCGTCTGACCCCGAAGGAACTTGCTACGCGCTACGCTATCATGTTCCCGCCGTCCATGCACAGCAAGGATGTCCGTC
GTACGTGCAGTGTTTTCATGACATCGATCGGTCGGAAATCGCCACTGGAGTACCAGATGGGTAAGACGCTGATCTACTTTAAGAACGGTGTCATGGAAGA
GCTGGAGGCCATGAAGTCCGATTTCATGTACTACGAAGCACGCACCATCCAGCGTATCGTGTTCGGCTTCTTGGAACGTCGTCGTCTGCGTAACAAGATC
CGTGCTGCTATCGTATTGCAGTCGTACGCACGTATGTCGTTGGACTTCAAGGAGTATCACTTCCAGCGTCGTGCGATCATCAAGATCCAGCGTGGCTGGA
AACAATACAAATCCATCCCCATTGAGCCCCAGTACGACGAGGATTACAACGACGATGGTCAATGGGTGGACGAGGCCGATGACATCGACGACTTGGATGC
TGACGAGGGCTTTGGCGATGACCCGGCATCGATCCGCGCAGGGCGTGGCCGGTCAATTGCGGACAGGATGGAGTCGTTCAAGGTGGCTCACTCGGGTCGT
CGTGGCAGCGTGAAGCGTTTGAACGAGCTGTCGGCGCGCGCCAAGAGCTTCATGAAGCCACGAAGCGGCAGTGGCAGCACTTCGAGCTCGAGTGGCATCT
CGTTGGAGGATGAGAACTCGATGCTCAAGATCGAGAACCGCAACCTGAAGTACGATCTGGAACTGATGCGTGAGCAGTGCATCGAGCTACAAGCCATCAT
CCTCGAGATCAACAAGAGCCGCAAGAGGTAAATCGAACTATCCCTCGCTGCGAGATGTGCATAAAGTCGAAGTCCGCAGCCAGGTGACAAACCAGTTTTA
AGTAAACGCCTCAAGGCGTATATCTGTAGCGAAAGACCAGAACAGTTTTCTCGTTCAACATGTGAAGACATTGAGTAGTTTTCATTAGTTGTTGCTGTTG
TTCTGGCCTTGACATCGCAGTCATATTTTTTCTTGCTCTCAGCGGGAGAGAACATTCGGATCGTGCAACGCTGATGCGCCGTGCTATCCAGATGGATATC
ATTCTCTCTCTTGTGAGTCACGGGCGACATGAAGATTGTGTGTGGCTTGGGGCAGCATCCCATCGGAGTTTCGTGCGTGCTTTGACTTACTAGGGAGCGA
AGGTTCGAGTTTTTCGAATCGGAGTGGTCAGGAGAGCTCGCGGCACTGCCGATAAATCGGTGTAGATGGCATTACTGATGCCCGACATCAATCTCCGTCG
TGCCAAGGTCCACCTTGAGGTTTGTGCTTGATGCATTCTTCGTTTTCATCTATCGAGTCTGCACTCGAAGAGCATTCCTATTCCATGACGTTGACCAGTG
GATTGTATTGTTGGCCGTAGCGCTACTGGCGCCAATTGCTTGGCGGAGACCGGCCAGAAGAGCTTCGGCGTTTGATATTTCGATCCAAGGCCGTTGCGAA
AGTCAGCCAAGATGCACAGCCAGCAAATGTAAATCCCGTCGGTTCCGTCGCGGTCGCTCCACGGATTCAAAATCTAGAGCTCGACCCGGAAATGGAGGTC
CCCATTGCTACCGTCAAAGAAATTAACCGCGATTCCCATGACAAGCGCTGCGTCGAAACAGATTGTGGATCTCTATCGGTGGCACAAAGCGCGAGTTGCA
ATCAGAAGACGGAGACTGAAGCTGCTGGCGACGGCAAAGAGAAAGACGGGGACCAGCACAACGAGTTGAATCAAGTGTCTGCTGTCGAGAATGCAACTAC
AGACGATAATTCAGAGTGTAATCAATCTGCTACCTCCGAAAGCGCTGACGAATTTCTGAAGTCAGGATCGGAGCAACCTCCATCGTCGACGAGCACAACT
GGAACATCATCATCCGTGAGCTCCATATTCAGTGTGTCAACGTCTGATAGTAAGTCCAGTTGTGCTGGTAAGCCGCCACTATCGCTTGTTCGTGCGAGCA
AAGACAACCGGCCAAGTTCTTCTCCGGAAAAGATGCGCCAGTCCAAGTATATTTCGCGCATCCAAGGTCAGTTTGGGGCTATCTCTTTGCTGATTGTGCC
TAGCTGTTGACTCATTTTGCCGTTCATTTCTTGCGCACAGGTCCGACGCTGGGCTCTATCTTGCAGCGTATCCATCTCAACGATGGTGATGTTAGTGAGC
TGGACTTCTCTACTCTCGCGCAGCGCAACAAACGGCTGGAAGCTGAAGGGTGCGCTCTTGTGGCACGTTCTCTATCCACTAACCACACCGTACGCAAGCT
TATAATTCGGGACCATGCCATCGGAGACGATGGAGCTGTTGCTCTATCAAAAATGCTGTGCAACAACACGACGCTGGAATGCCTGGATCTATATGGCAAC
AACATCGGTGATCGGGGAGCTGAAGCATTGGCACAAGCATTGTACGGACACGACTCGCTGAGGCGTTTGTGCCTGAGAAGTAACGCGATAACGGATCGTG
GCACTGCAGCGCTAGCTCAAGCCATTCGTTGCAACTGCACACTCAAGTCTCTAGATCTGGTTCACAACCGAATTACAAAAGCTGGAGCTCACGCGCTACT
TGACGCTTTGGACGTCAACATTCATTTGGAAACGTTGACTCTGGATGCAAACGATGTACCAGCATTTGCTGCAAGTCAGCTTGCATCAGCACTGGCACGC
AATCGTGCTGAGTCTTTAATGATGGAGTCGCATGCCGCAGAGAAGCAGGCTGTGAAAATTGTACGTAGGGCCAGCGGCTTGGATACCGAAGATGAAGATG
ATAGTGACAGTGGGAAGGAGGAGAACTGGATGGAGCAAATTTGGGAAGATGACGACGGTGATAGTGTGTCGAGTGGCTTCCTGAGTTGCTCAGGTGTCAC
GGACGTTCCGTTGAGCAGCAGCGGCTTGTGGATCTAAGAAAT