Description :
From Genome Similarity Track
Location :
Scaffold_45:129194- 130430
Transcript NameFunction/comments
g3268.t1OWZ03565.1 hypothetical protein PHMEG_00024682 [Phytophthora megakarya

Sequence
1236 bases(100 bases per row)
TCATTCATCCCCACTCGATAGAAGAAATAGCAAAAACACCTGTGCTTTTTGAACATATCACTGCATTCCACTCACTAGCACTGGTACAGAAAAGGACAGG
TACTGTGGCTGTGTCAATCACAGGGAAGTTTTGATTGGTTGTTTATCAACCAATAAATTTAGAATACATTGAACCAGCTGCTCCACGAATTCCCTACAAC
TCAAAATGAGCGGCGACCCCTTCTTCACGGCGCTCGAGCGCCTGGTGGCGGACGGAGACTACGGCGACACGGGCTACGACCTCCCCCGGATCAGGACAAA
ACTTCAGTATGGCAAGGAGCGCTACGTCTCCGGTCCTTTCTCGTGGGAGAAGGTCATTTCCACGGATGCGCCAGCGCTTCTTTTTCGAGATGCATGCAAT
GACGTGGCAGGAGTCCGTGGCCACGCACAGATGCCACTGGACCCCGCGCACTTGCTGGAGGGTATGGAGGCGGGCAGTATCTTCGCGATGGTTCGCAATG
GTGTTACGAAGGCCAACGAAGCGGGCGTCTTTTGCCCTCCAGACCAGTGCGCTGTCGAACTCGCGACTTACTACACCAAGCTTGGCTTTCCACGCAACCA
AGCCTACGTGTGGAAGTCCGAGTACTGGCTACAGGTCGGGAATCGCGAGTCTGCAACCCACGTTGATCACGGACGGGTCGTGTCCTACATCCCGCCGTGT
GCCCGCCACTGCTTTAAGGTTTGGGTGTTTTCCCCCAAGGAGTCAGTCAAGAAGATCCAGTTCAACTACGGCAACAAGGACAACTCCATCAGTCGGGTGC
TGCACACACCATACAGTGGGGTTCTCATCCAGAGACCAGGTCACATCGTGTGCCTGAATAATCTGGTCTTTCACTCCGTTCTATTCACGTACCAGCCTGA
AACCCCTGATGAGGACAGATGGGGAGGCATCTTTGGAGATGTCATCGCGTGCGCAACGGATCGCATCGAGTCTTTCCGCTACGCGACTAAGGTTGCTTCA
GGATCCAAGAAATCGTCACGTAAGGCGTGGGAGCCTTTGCTTTCGGCGTACAGCACCATGGAAGAGGGCGGTTACGACCCAGACAACTACGAACAAGTGC
TGAATAAGTTCCTGCCCGAGCTGAAGCTAGACGATAAGTCCGAGAAAGCGCGCGTGGGAGCTGCAGCCAAGGCGGACAAGAAGCGAAAGAAGAACCAGAA
GATGGAGAAGGTGCGCGCCGCGAAGCGCGAGACGTT