Description :
From Genome Similarity Track
Location :
Scaffold_134:12918- 17067
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_134-snap-gene-0.28E3 ubiquitin-protein ligase UPL6
Pytap_DAOMBR444maker-pag1_scaffold_134-snap-gene-0.29Conserved gene of unknown function

Sequence
4149 bases(100 bases per row)
CTATGTCATCTCGAAGCCAGCGCCTGATGAGATCGCGAGCAGCAGTTTCGCTCGCAGGACCTTGTAGGAGCCGTAGGTGGGGAGCTTGAGCGTGTTGAAG
CATGTAGATGAACTCGGgAGCAACTCGTCGTCGCGGCGGATGGGGATTTTCTGGATGCAGAATGGCGGTGTGAGCGTGGAGAAGCCCAGCGACGGCGCGC
GCTGACAACTGGTTGAGAAGCGCAGGAGCGCGGCCCGTTCAGATGGCGTGAAACTCTCCAGTGCCTGCCAGAACCACTGAACGCGCTTGTCCAGATTGTA
GTACCCGCcGCTGTACTTTGtGTGTGCCTTGAGATCAGAgACATCGATGTCTCCGCCcTTCCcGGAGATAAGAACTTGGAGCTCAGGCTCGTTGAAGAGC
TGGAGCCATCGCACGTCAATCAGATCGGCAAGCCCAGCGCGAAAGGCAGAGCTCTGCTCTCGAATCTGCGTgTTGAGGTAGTAGTTGGCGACGAGATGGA
TGTAGCGCGAGCGAGTTGCaTTCGTCACCGTCACACTCGCACCGTTGGGTATTAGATCGATCTCGCGCTGCTCACCAAACATATCCTGAACAATCGAGAA
TGTGAGGCCGAGGTCGGCGACGTCTCCTTCAAAAGACTTGAGGAACATCAGATTCTAACAAAAAGACATCGCTATCAGAAGGAGGTACGGCACTAAATTT
TAGCTAGAACGCACTCACTCACCTTGTAAATTTCAGGATCGAGCGACGGCAAATCGCTCAGGTGGTTGAaGgAGTGCAGCAGCTTGGACAGGAAGAAATG
CGCAAACTTGGGCTCTACAACAATTCCTTCATACAAGGCCTTCCCGAGGATTCGACCAAGAAACTGGAAAAGTGTCAGGTGGTCTGTTTCTCGAACGAAG
TGAGGAGATGCAGACAGTGGGTTTGGGTACAGCAACTGGTCCGTCGGtGTCGTGAGGAAGAGGCCgTACTCTAAGCCGAATGCATGGTTTGAGAGATCGA
CCCAAAACTCCTTGAACAGGCcACCcGCATCAATACCcACTTCTTCGcGCCCAGCTGCATTGATGAATGTGACATTGATCTTCTTTTtGAGGTTGGAGCC
GATGGCATTGATTTTCGTCAGCCCATCTTCGAGCACTGCAGCTCGTCGAATGCGCACTCGATACCCTGGCCCTGCACTTCCAGAAGtcGGATCTACCTGA
TGAATCCGTTtGtCGGCATCAATAaGTCGCTGAAACaGCTTTACTCGTTCCGGGAATGAGAGTATGAAAGGAATCGAaCCGATCAGTTTGTTCGCGCGCG
GTGTGCCAAGCAACACCTCTTCAATCAACTgAGATGCGTTGAGACCTTgcAGAACCcTGGGGGATACGCCGGGCATAAGAAAAGATGAGGACAGAACATc
TGCTAGAACCAgCGACAACATACCAGCTCGTAACGTTACAGAATGGAACACGTGAGCAGCGGTTGTACAGCTCACGAAGTAGCCGCGTCGCAGCATCAAC
CAGAAAAAaTCCGAAGCCGCAGTTACGGGCCCTAGCATCATCGGGCGACATTTGGACGCCATTTTCCCAGTATGCGGAGTGAAGAGCATGCTTCAGACCG
ATGAGGAGACGCTCAACTTGCCGAAGAGGAAGCGGATATTCTTCCTCGTACATCTACACAGAGGATCGAGGTTTGGATTAGGGTAAGAATCACACGAAGA
GAGCTTAAGCATTACCTCTTCGTCGTCCAGCACGAGTAGTAACTGACTGTAGACTACACACAACAACCCAaGGATTGTCTCAGGAGCTTTGGATGAGTCT
GCGTCGAGGAAATTCACGGTCTTGaaaCAAAATGAATCAGAACaaaaTTTTGTGAAGAaTGCACGTGCGTTAAAATTACCTTAGCGAAGTCCTCGAAATC
CGTGATCTCTTGAAGCAGACACCACAAGAAGCGAACGAGATGGGCATGCGATTCACcAGAACctGtAGTCGCAACTTTGTAGAACGTAAGCACGTTCAGG
ATGTTGCCTGAAGCAGCCTGATAGCCATGAAGATGCTTCGTCGAGGCTGGCCATCGTGATAGAACTGTtGAAAGGAGTTGCACCAGTGCAAGGCTCATGT
CAAGGTCGAATGGGCGCTCTAGCCCAGCCTTCTTCaCACCATTTACTGAGGTAGTTATTGAAGCAACTGGTGAATCTACACCAGGGGTATTGATTTCAGT
ATGCTGCTGTTGGGAGGATGCGGCAAATGTCACGCTTTTTCTCAATCCCGTTTTCTCAAGAAGCTTTTTGGCCCAGCTTGCCCTCCCCAGAGACTTAACT
CGAGCCCAAGTGGCACTGATAGAATGGTGGAATGACGACGAGGAAGCAATTTCACCGAATCCATATTGCTCCTGTGTTGTAAaTTGAGTTCAATGAAAAC
CATGACTGAGAACCACTACAAGAGAACTTACATGAACTGTCGAAGCGGTTGGGTGCATCGGAAGTGGCTTTTGTGTTACGAGCGGCTTCTTCAAGGCTTT
TGGGTTAAAGTGAAAACACTTTTCACTCAAATATCGGACCTgTCGCTCTTTCGACAATAGTTGGAGTTGACTGGTCAGAGAATCGGGAAACACGACTGGT
ACTGAGTGCGAGTCCGACACTTTGGTCCAGGAGATAGCAACACCGGAGGGGGCAAATGTCTCCGAAGGGACAAAGCAtAGCACCTTTGCAAACATTTGAA
GTTCGTGAGTTATCGAGGCTGGCTTGTGGTTGGTGTCGGCCACACTATAATCGAACATATGCGTTAGATAGAGCTCCGCAGCCCATACGTTAGCACTCAC
CGATCAGACAACCACAAAAGATTACCAAGTAGCCACGTGATCGACGGAATCCCCTCAGAGGGCGGAGGTGGGAGGGATAGAGGTAACACGAGCACAGTCT
TGACGATGTAATCCCAGAGTGGGAACAAACTGGTACTTGCAACGACTTCAGGATCAACGAGTTCTGGTAGAAGTGGAACACTGAGAAGCTAAAGAGTACC
CATTAGGGATAGTCGCTTGCTTCAAaGCGAACTGCTTACCTTCTCAACGAATGGCTGCACAAAATCTTGATGAGTATTCGCGCACTGAACAGCAAGCTCG
AAGAGATGAGAATGGAAGTCTGAAGTCGCAGACTTCGAGGACAGCAGCATAGATCTCCGGACGACATCAGTGAATGGTAGCCTTACACTTGGAGTGTAAG
GCCATTgcTTAAGCGATAGTAATCGTACACTTCGCGCATTCGTTACCACATGGCCATTCAACACGGAGAACACGCCCATCAGTCGCCGAACACAGCCGAC
TGTGGACGCTGCACcATCCACCTGCGATTGAAGGCATATGTCCACAAACATTTCCAGCAGGTTCAGGCGCGCTGgTGGACGCGCACTGTCGCGAAGAGCT
GCACATGCATTCGAATCTTCGACTGTCTCCTTGAAGAGTGCGCCCAATTGGCAGAGCCGAGCTCGATCTCCGGAATCGTCACTGAAGAAAAaCAGCAGAC
ACCTCAGTAGCTCGAATAGTGCATCGCCAGGTAGAGGCAATGTCTCGCGCTGCAGCATCGCCTTTAGACGAGCGATGTCGGTCGTCTTCGAGTCGAAGCC
ctCGCGCCGTGTTTTCCGCTCGCGTCGCACGTCTGTGCGGCCTCGTACGAATCGCTGTACGCAGAGGGCCGCCGCAGCCCTCTCGCGCTGCTCGGCTCGC
GCCTGCCGCTGCTCTTTGGCCTTCTCCAGCACGCGCGAGCGGTCATCCCCgCGCCCAGCCGCCCGAAGTTCCTTGTCGCGGCGGAACATCGCGTGTCTTT
GGATGCTGGAaGgCAGTAATACTGACACCGGAgAGGCTAAACCGGTAAGGATACGGTACGGTATCAGAAATATGAGATCAGGTTGAAGTCGGTCTGTATT
GAGTCACGAAGGGCgTCTCTACCGAGACTTAGAAGTAGTGAGTGATGACGTACAGGATGACGCCGCAGCCGATCATCAGAACAGGCGTGTCCATCGTGTG
TGGAGCAGTCGCCTCCGCGTACGCCATCGTTGGCCCCAGGATCAGCATCGCCAGAAGAACCTGCGTGAAGTTGGCAAAGTCCGCGTACTGCAGAGCAGGG
AAGATCATACCCGACATGAACACACAGGCACTGCCCTCCCAGCTACGCG