Description :
From Genome Similarity Track
Location :
Scaffold_283:12917- 15192
Transcript NameFunction/comments
Phypl_g6423conserved hypothetical protein
Phypl_g6424conserved hypothetical protein

Sequence
2275 bases(100 bases per row)
GCCAGAACTCGCAGCAGGATATTCGAGCTTGTCGCGTTTGAGCGCGCTTCCCGGCGGTGAACCCTGCGACGATGTGTACCCTCTTGCATTTTGCGATGCC
CCACCGGGTTGATAAGAATAGTTTTCCTTTTGGCGCCTGGCAACGGCAAGTGCCTTGCGCCGTACGTGTTGGGCGCAACAGCAATGCGACTAAGTCGCGT
CAAGCTGAACCTTCCATCGGTTATTCCCCCGTTCGAAGGGACTGAACACGCAATCCCTTAATATGCGGTTTTGTATGTTATGCAAATCCTACCAATGAAT
ACCCCGCGCTAGCCGATCTGGTGGCGTCATCACCGACCAGGGCTGAATCCATGCCGCTTCGCTCTGTACGGCTGCAGAAACAGACAAAGGGCAGTCAGCC
AGCAAGCACACTGTCCTTGGCACAGTCACTCGAGAAAACTCCCTCcgcccgagcagcagagacgGCTCAGCCTTCTTCTTTCTTAATTTGCCAATCAAAA
GCACGATGAACTACCTGTTCGGGTACGGAGAGACGCCggcgacggaggagcaggtCAAGCCCCAGGAGCCCGCGTACCCCAcagccgacgacgtggactt
cgAGGCCTACGGCAAGGAGAACATCCAGATCCTGCTCAACCGCCACTCGGGTGACGACAAGGTGAGCACGTGggaggtcgtggacgacgccgacggcgtG
CAGATCTggcgcggcgccgtcgaggaGTGCGACTGGTGCCCGTtccgcgccgcgcgccgcatCGACGCCGACAAGCGGCTCATCGAGCAGGTCCTGCTGG
ACCCGAACCgcacgctcgagctggacgagatgatgGAGGGCGTGGTCACGCTGCGCGACATGGGTGAGTCCAACCACCTGGCCTTCCGCCAGATCACCAG
CAAGGGCCAGTTCCCCATCTACGGCCGCGAGTTCCTCGTGGTCACGTACGCCACCACGCTCGAGGACGGGCGCGTGGTCATCGCCACGCGCTCCGTCAAC
GTGGCGGACGTCGCGCCCCTCGAGGGCTACGTGCGCGCCAACATCTACGTGTCGGGCTACATCATCGAGGAGTtcaaggaggacgacggcaaggtgTACT
GCGTCGTGACGCTCCTCGCACACGCCGACCTGGCCGGCTACATCCCACCCAGCATCATCAACATGCTGGGTACGTCCTCGACCGTCAAGGTCCTCGAGAG
CCTGGAGGCGATCGTGACGGCCAAGTAGACTGACACTAGTAGTTAGACCCGCACGAGCGCTTGCGAGTCGTCATCACCTTTAAACCGCTCGGGCAGCTCG
TGCAACCGACTTTTTTCTACAAGAATACAGACTATGGTTTTGGAAAACGCCTTCGCTTCAGAACGTCACGAATATACATTTTTGGAAAACGAAAATGGTT
TAGTCTTGGTCATCGTCTGCATGGATGAAGGTGCTCGTTGTGCAACGTCAGGGAAGATTGGAGTGTGCCTGCGTTGATACCTGAAGTGCATCGAGCGTGC
TGCGCTATGCAACTACTAAATAAAGAACGACAGCTTGGGGTTGGAGAAGTCGACAGTGTCCATCCTGTCAGCCGAGACAACAATCACGGCCGAGTCTTGT
GGGGCATTGGCCGCTGCCTTTTGCCCAGGATacgccacctcgtcgtcgctttcaTTTTCGCCGATTTCAGTGGGCACGGGGGTTGGAGCGATGGTGAAGG
CCGACTCGTCCGAATCCGAGTATCGGTACATAGCGTTGAGTTTGTCTCCTGCTGTGCTCTCAGGCGACTCAGCCGTTGATGAGGAGGTCGAGAGCTCTTT
CATGCCTCGCACGACCGAGTGTAAGCTTTGCCGTTGAACTTTTTCGGTTTTGCTTTTGCTTGCTGAAGcactgctcctgcttcgGGCATCAGAGTCACCA
CTCTCAGAACTTTCGTGGGTGCCACTGCCGCAATCACTTCCCTCCATTTTGAGCTCCACCGAAAGCATTGTCGATTGGCGGTCAGTTCGCGGGATGAGGG
ACCACAGCGAACTGGTTTCGCGGACGCGCTTccgctcgtccagcttcatCAAATCGGCGTACTTGTCCCGCGAGATGTTGGCAACCTCGATCATAAACCC
ATCCTTGGCCTCACGCTTGTCGGGATCAAAGTTGCTGTCGCCACGCGGTGCACAGATCGACACGACCACTTCCTGTGCATTCGTCGTCGACACCAGTCCT
CGGCTGGGTTTCACGACGTAGCCCGACTGGTTCGACGTGCGCACCTTAAAGGTGAGGCAATCGTTCTGACTCGAG