Description :
From Genome Similarity Track
Location :
Scaffold_2:129155- 130883
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-1.37Callose synthase

Sequence
1728 bases(100 bases per row)
CCGCGATTTCTACAGCCGCATAGAGGTGGCTGCTCGCGTAGAAACGGTAAAGCTCGTCGAAACGCGAGTGCTTCGTCACAAAACCACGGCCCGTCGCACG
ATACTTGGCACCACCGGCGAGAATCGTCTGACCGTAGTAGAACCACTTGGTGCCGATATGGAAGAGGAAGTACAGCGGTCCGCCAGTCACAAAGATCATG
AACACTTCCTTCATCGCCGCCTTGAAACCGCGCTCCACAGAGATCGTCGCCAGCAGTGGTGCCGTCGTGAAGAAAGCCACAGAGCCGAGCATCATCTGCA
GCTGGCTCAACAACACGGGCGTGCGACCACCGACACCTTCCAGCGAAAGCAACGCGCGCAGCAAATTGCAATACAGCAAAATGTACACGGTCCAAATGAT
CATCGACATCGACAGGTAAAAGCCCACGTGGTTGTAGTAGAACGAAAGCAGCTTGAAAAAATCCAGACGCTGGCTGATTCGGTACACGTCACGCGAGAGC
GACTGCTCCGCCGCACCCTGCGCAAGCTTCGCCTCGAACTTGTAGATCTGCTGCATACCGACATCACGACCCTTACCGCATTTGACGTACTCGGGGAAAG
TCACTGATCCGCCACGCAAGCAGTTGTTGTAGCCAGCAAAGATGTCTTCACTGAGGTTAATGCCCTTGCTCGCTTTGCTGATACCACCGCGTGTGATGAA
GAAAAGCTTGTTGAACACATCCGGGTGGCCGTAGTGGAGACGCACGCGAAGTGGGCGAGCCATCGTACGCTGTCCCAAAGTCACGAACGAGGTCTCCTGC
AGCGCCATGTAGTTCGCCAACGAACTCACGCTTCCCGTGAAAATGTGCTCGGGGAGACCAACAATCGTGTACGGACGATCTGGCGTACCGGCATCAAACT
CTTCAAGCATGTTGCGCATCTTGAGTGCTTCTTCAATGTATCCGTCTTGGTTCATATCAATCGTCTGCAGGTTCTCACCGCGCGTGAACACAATCGCCGC
GTTCTGGTTTTCTGGCTTGCCTTCACCGAGAATCGGGTTGCCTGGGAGGCGAATACGGTAGATCTCTTCCACCGACCCAATGTCTTCAGCGCCCTTAATA
AGCACCGCGAAGTACGACTGGTCTTTCTGATAGTTCACACGCACTTCGTCGATGTACGCGACACGCAGGTTCGGGAATCGGTGCAGCAAAAACTCAATGT
CCTTCGCTTTCGGGTCGTTGTTTCGCTTCTGACGACCATAGATCTGGCACGCCACCACGTACGTGAACTTCGTCTTGATGAGCTCTTCAATGCGCTCCAC
TGGAACTTGCTCGATCTCAGCGAGCAGTCGGATCGCAGCTTCACCGTACATCATGCCCTGCACAGTTCTCGACAAGGTCTGACCGCGTAAAGACGCCCAG
AGACGCAACTCAATCGCAGTGTTCGGATCCTTCCACAGGTTTTTCTTCGGCTTGACGCGCTCCAAAAAGTTCTCCCAGTCTTTCTTGTACAGCGTCTGCA
AGAAGAGCAGCGTGTGCACATCCAGACCATCTTGCTTGCTCTCCAAGTCGGACTTTGAGTAGAGCACGTCTTCACCGTAGAATGGCGTCATCACGCTCCA
CGACTTCATCTCTTCCAACAGCGGCGCGAGCGGCATGTCCATGAAGAGCGAGTTGACCCAGAACAAAAGTCTTCGCTGAGCATCGTACGAGCGTGGCTCA
GCATCGATTTTCTGAAGAGTCAGAAGAC