Description :
From Genome Similarity Track
Location :
Scaffold_58:129151- 131453
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16530hypothetical protein
Phypa_INRA-310PPTG_16531hypothetical protein
Phypa_INRA-310PPTG_1653260S ribosomal protein L4

Sequence
2302 bases(100 bases per row)
GGTACCTAACTCGGTCTTTCGTGGAGAGTCACGAACTGGCCTACAGCTTCTGTCGATTTCCGGATTGCTCGCTGGCACTTGAACAGCCTCGCGTTATGGG
TGCGTGTACGATGACCGATGGGATCTACTGCTGGCCTGAGGGATATTGGCACTACGTGGGCCATCACCACGTGAAGCCACCGCAGGAATTCCTGGACCAC
CTGCTGGAGAGATATGGCACGATGGCCGAGATGACGAGGAAAGCGAGAAACGAGAAGAAGCTGCTCTTGTGGGATGATATTGAGCAAAAGGCTATGGAGA
TGCCTCGAGCTATGCAGGACTGGATAACAAGCTACACTACTATACAAACGGAATAAAACGTAAAGTCTACCAGTCGATGATGTCACCCTTCCCAAAGTGA
AGTAGTTGCAGAGGATCTCCAAGTTTTGCTCGATCAATTAGACGCACCATGCCTTCGACACTTTCCTCAGGCTCCACAGCGCCGTTAAAGTTGTTGTACG
CTGTATTCACATTGCCTGGATGCAGCAGCAAGCATCCGATCTTTTGCGGTTCCAAGTCAATCGCCAAGCTCTTGGTAAACACATTCAGAGCACCTTTCGA
TGCTCGATGTGCGTATGCTCCACCTGAACTGTTATCCGATATGCTGCCAATGCGTGACGTGACTTGAGCTACAAAGGAGAAACCTCTTGCACTCACTGCC
AACCGGAGATTAGGCAGGAGAGCACGAGTCACTAGCAGTGGACCCAACGCATTCACTTGAAATTGCCGTAAACAGTCCTCCGAAGTCGTCTCATTCAGAC
TATAAAGTCCAGACGCACCAGCATTATTAATTAGCAGATCGATCGCCACTCCTCGCAGCATCGTCGCAATTTCTTCAATCGACTGCTGATCCGCTACATC
CAACGGGATCAGTCTCCAAGGGTATAATGATTTCACCTGCAAAAAATACACCACAATACACTGTTAACCGACAGTCACCGTAAATTCAAAGCATTGCGAT
GTACATACCTCGTCCGCTGTGTTCACATCTCTTACGGCCGCAATGACATTCCATCCTTCCTGTGTATAATGCTTCACAAAGGCCAGTCCAATGCCTCTAC
TCGCCCCCGTAATCATCACTGTCTTCTGTATTGGTCCACTCACAAGTTCCGTCACTCTTGGGGTCTCTATCGTCGTGTCCACACGGACAATTTGCCTTCC
CGGGGTATTTCGTGCCAGCGCTAAATGGTCTGTCACGTCGGTTAATGTCCTTTGCGGTTGTCCCTCTGTGGACACAGCTGCATTATCCACCAGTCCTGAA
GTGTCCTCCACTCTACGACGTCGAAATTCTCTGAATCTGATTCCATTCCTTGCCATAAAATTGGTCATCCAACCCACCGACAAGCCAAGCTTCGGGCGTC
TTTCGGGCGGCAGCTCTGCCACAATTTCCTGTGCTTTTTGTACCAATAGTTTCCGCGAGAGACGCACATTCTCAGCGTTGCAGGTGTCCACAAAGCTCTT
AAGTGCCGTCTCCAGTTCAGGGCTGACTACGTCGCGACCTCGTTTTGTGACCCCTAGACGATGTTTCTCTTCGATCTCTTCTGCCGTCAGGAGAATCTTC
TTCACCGTATTGGCGGACGGCGCACGTTCCAAATTGAAGGCGGCCATAGCCCATTGCGCCAGCTTCACCTGGGACAGCCCCGGGTTACGCCGGTGCTTGA
CGATGAGCTGGTACTTCTCCTCCACCGTTAGCCACTTGCCCATGATTCACAAAAAAATGTTCAATATGACGTTGAATGAACCAATCAAAACGATCATATA
TTACCGAAATGCATTAACATTGAAATACCCCCAATAAATTACCAATACTGCTTGTTTAACGGTAATTTATTCAAAGAACCCATACAATTGGCCATATACT
AGTACTACTACATGTAACATTCATCCGCTTCCTCATGAGGCAAACACAAGATGACACAAGAGTTATTGAAAGCCTCTTTCATGGCCTTTTTCATTGCTGT
TCCGCGAAAACTTATCCAATCCTATTGCAGAAGTCAAGGACTGTAAAGCTACTCACAACTTAGTCAGACGAGTTCTTCTCGAACAGAGCGCGCGACTGGA
CCTTGCGCTTGGGGTCCGTCTTGCACGTGTTCTTGCGGTTCTTGCCGACCACAGCAGCCTTCTTCTCGGCACGCAGGGCCTCAGCGCGCAGCTCAGCGCG
ACGGGCCACCAGCGTGTACGGGTTGAGCTTGACCATGGCACCCAGGTTGCGGAGCGGGTTCTTCTTCTGGAAGCGGCGGTGCTTCTCGTACTTGCCGGCA
CG