Description :
From Genome Similarity Track
Location :
Scaffold_650:12915- 13917
Transcript NameFunction/comments
g17835.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCATTGGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATATTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGG
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCTCGGCCTGCGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCGCATGGCATTCA
CGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACATGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGGTTGGCTGCCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTT
GT