Description :
From Genome Similarity Track
Location :
scaffold_135:12911- 13985
Sequence
1074 bases(100 bases per row)
AGCTGAAAGCTACCGAGAAGGAATACCATGTTCATAGCATGGAACTACTCGCATGAAGAATGCCCTCGTCAAGTCCTGAGTGTACCTGTTTAGATCCAAG
CCGTTTATGGTCTATGCAGATCATGGGTCGTTACTCACAGCAACGTCATCACTGCATCTCTACAAAGGATGACAACATTTGTCATATATGTATTTGGCTA
AGGTATATGTCTATTTGATTTAATGTGGTGACGATTGCGCTTTTGCGCCACCCTAACTCTAGAACGCCAAAATGCTGCATATCACAACGGTGATGTCTCC
AATTATTAGTAAGACGCAACAAATCGTCTTATGATTTAGCTCAGCGGTGTTAATATAGGGTCTGACGAAGCCGTGGAACTATTTGGTCGACTGCATGTCC
TCCTAAAAATCGTTCAGCGTAAGACCTAGACGCAGTATGCGCTGCTGAAAGCTTCTGGAAGGAAAGGATCTTGACAGCTCCCATCTCGTATACTTAATCG
CTTGTTTGCACGCTACCAACGTTGTGCCTTGTCCCTGGGCTCGCTGAACTACAAGGATGATCTAAATGACTTTCAGCGTGTAGTGCTGGTTCGCGATAAA
GAATTAAAGTTCAGCACTGCGCGAGGTACGAGATGCCGCATTGCGTGACCAAATTGGAAATGAATAGGCATTCTGCTCCGTGAGCGCTGTTCCAGCATAT
ATAAGCTGGAAAGCGCATATGTGCTCACGTGTAAAACTTATCAACACGTAAAGCCTCGTCGCACGCAGCGGCACCTTTGGTCAGCCTACCGTTTCGGGCA
GAGCATTGGCAGTCCGTAATTTGTGTTTGAACTTTCATAGGACGCGTCTCGTGTTGTGATCGTAGTGGCTGTCTGAACAAAGATGACTCATTCAGCACTG
TCAGCGATTCTACTGCTGGTGAGAATACATCCAAGCTATTCATCAAAAACGTCTACCGACAATTTGGATATACGGTGGCCATTGTTTCGAATCGAGATAA
TTGGTCTGCAGCAAAGTTGTCGCGAATTTGTTAAAGGTGCTCGGTACCAGATTCGACATGTCGACCCCTAGCCA