Description :
From Genome Similarity Track
Location :
Scaffold_790:12911- 13940
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_790-fgenesh-gene-0.4Protein containing a histone methylation DOT1 motif

Sequence
1029 bases(100 bases per row)
TCGGCGTCGTTGAAGGAGTATGTGTAGCTCTCAACGGTACGTGTGATGTGGCCCTCGATGCTCGCCTGGAGCTGTTTCTCCAGCAGCACCCTTGCGTTTC
GGCGGTTCTCGTTTTTCTGGTGTTCCATCTTGTTCTTCTTAAGGATTTGCTGATTGAGACAGACAGAGAACAACCAATTTCAGCATTTCCGACAATTTCC
AAGACCGATCATGCACGGCTTCAGTAGCAAGCAACAGAGACTGACCGTACGGAGTCGTGTCTTCTCGTCCGGACCAAAGAGTCGCTCCATCATCGCCTGG
TTGCTCGCGATCGCGGTCGACGAGATCGCTTTTGTCTTCCCGGACGTCCCAACGCGGTTCTCGTACGGATCCTGGAGCCCCGGGACCTAAAACCACGTGC
AAATAGAAGAACGCCAGCAGTTAGCGGTACGATACGGCTAGTTAACCGGCTTTGAGGCTGCGAAATCACCATTTTTGAGCAGTAGTCCGAGTTCACGCGG
AGGTCGCACTCGAGCCCGAGCTTCCGGCTGTTGGCTACAGGTGCAATATAACTGGAACAGTGAGATTTCTAATGAGACCATAGACATATTTTATGCAGCG
CACCGACAGTCTGGAGAGAGCTGAGCCGCGTCGAGATGATCGAGATCATCTGCGCCGTGATGGCTTCTTTCTGGTGCAGCGACTGCTTGAGCTCCGCCGA
GTCGTCCTCTTCCGAGGCGGCCCCAGCAAGTCGGCCCATCGTCTGTCGTGCCTAGTCTCGGGCTGATTGATTGACAGACAATAAGCGAATGGTGAGGTCG
ACCCAGGACAACTGGGGGCTATTTTGATACTGCAAACTCTCCCCAGCATATCCATTCGACCTGCCAACCTGGACTGCAGTGTTGATCAAGTGGAGTGGCG
TTTGTGCATCAGCAAGCACGCCCGTCAGTGTGGACATGTGCCAACAAGAAAAAACTGAATGGGTGGACAGAGGTGACGACATGTGACCGTTGCACTTTCA
CACGAAGACAAAGCCTTTCAGTGCAATCC