Description :
From Genome Similarity Track
Location :
Scaffold_184:129075- 136715
Sequence
7640 bases(100 bases per row)
TCCTCTATAGGTGACTTATAGTTTGTAAATTTAACTCAAGCTTAGCCTATCTATAAATATATTCAGTTACAACTTACCTTAAATTGGTCACTTCGCTCCC
TTAGGCAAAAAGGGACTTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTTGGAAGCCAACCGCAAGGTGCTGTGTGACCCCGTCACACTTACCGCGA
ACTATTAAGCAGGTGATACATAAGTATCTTTCCGCAGTTTCTGCCCACGGGAATGTTATTTAATCTTAAGCTCTTTGCTAAAATTTACAAAGCTATTTGC
GCAATTCGTTTTATAAACAAGTCGGCCGGACAGCTAAGATGCTAGCCAATAATTTCCGCGGCTGCGCGGTATCACTTCTGGTCTTACAGTATATGTATTA
CTTCGGGGTAGAATTGGTGGATGTTAAATACTTGTACTTGTATACACGTGTTCCTCACTAAGCTCAGAATACAATACAAACACTCACGTTTGCCTACTGA
AGACTCCATGTACAAGTAAAAATGTCCCAATTTTTGGCGAACCTATTGGCATTAAGACTCTACGATGCTCAGCCGAAGCGGAATAGGCAAAAATATCTCG
ACGCTTTTGCAGGTCCGATACCGCGCATACTCGCCATCTCTTCTTTTGACGCAGGTTCAGTCTCAAGGATATCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTCTGATCTTGACAAATGACCAC
CAAAAGAATTGTTGTCGAAATTGCCGCCGCCAAAGAAACACAGTGCCACGAAGGCCCCCACACCAAAGTCAGTAACAACACCCACTGCAGTCACAGTTGT
CTCTAACACTTCACCATCCACTGAGCGTGAGCACGTCGGCAAGTACATGGCCTACGAATCACCGTTGAAGAAGCTAAAAAAAACATGAGCCAACACAAAC
GGCAGCTCATCACGACCATCGACGGTGAGTCTGTGCTACCATCATTCTCATACAATTATATACAGCTTTATAATGCGACTACTATGTAGAGCTACGCGAG
TTCATCCAAACCAATGCCACCTCCCTACCTACACTTTGCGGATCTGTCCGGATCCGGGGTCGGCATACGTGTATTGAGACTCTACCTGGGCGAGCAGCAA
GCTCCGGATCCCCTTGAACAGCAACGACAAGTACGTACGCCTTCAACTTACGTAGAACAACTAACCCTAACATTGTTATAATACTTGTGCATCAATAGGA
ATATCAAAAAGCGCAGCGAGAAGACGAATTTGAAACGAACCGATACCTCATAACATTGTCGCTCTATGAGATCGCTCCCGATCATCCAGCTTTGCCATCT
CCAGGATCGATCATCGCGGTTAGCCCGACCAAACTCAATCTTTACCGAAACTGCTGGCAGGTCCGAGCCACAATGTCGGGGATCACGACAGTCATCGAGC
CTTGATTCTACTGCAATCGAACCGACATCTACCGATGCACGACCATTAGCTCACACGTCACTACTTCGCATATTTTATGCGTCACGATCACCAATGGTGA
TTCACCATGCAGCACAAATTTATGAACGTTGTCACCAGCACATTATCGGTTTATAATTTTCTTTCATATATGTTTATACAAATACACATTATCTAACCGC
AGATGGATCCTACATATTAACGTCATTATCCACAGCACGTTGTCATCAACATATTATCTAACCGCAGATGGATCCGACATATTAACGTCATTATTCACAG
CACATTGTCACCAACACATTATCTGTTCATGTATGTTTATACAAATACATATTATCTAACCGCAAATGGATCGGATATATTAACGTCACTATCCACAGCA
TGGACGCGTACTTTACATCATTCATAATATATCGTCACCACTACCGAAAACACACGAACATCGCCTCCTCCTATGGTCGAGCTGCGAACCCCGGATCATC
TGGTCCGGTACGCAATATACTGGCCGATTCGCATTCCGCAGCCAAGAACTGACCATCTACGGTACGAACCCTTGGTGGCGGTTAGGATGAGTTCGCGGAA
GACTTCGCGACTCTTTGAAGGCACGATCACCGTTTGGGAAAGGGCGTGAGTAGTTAAAGACGCGCATGCAACGGTGCAGGCGACGCTTGGCGAGCAAGGA
GATCCCTAACGGATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTCGGAATAGACCCGAAAGGGTAAACATAAATACAGAACCGAAT
TTCCACTCAAGCACACAGAGCGACGTCTGACTTCAAGGTAAGCGTCTTAATAAGCTTGTTTAGTGTCTTTTACCTGTCAGAGAATTCGAAGCTCTGTAGC
GAGGGATCATCCGGTAGGCCAAGATACTGTGTGTGTATTGGCCGATTACTATCGGGAGGTTTACGTTGTGGCTTATTGTTGCCGATTTGCACGACTGGGC
GTGCGTGCATTGCGTCCCTTTGATTCTTCCAACCGAGTATTAAACACTCGGTGCCCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGATGGGA
CCAAGAGGATTCATAACACCTATTAGCTTTGCTCGTGCTAGTAGCGTGCTCTTATTTTTACTGGTTGACCTATATAGGTACTTTACAGGGTTCAGTCTGT
CCCGGTGCAAGCGCAGAACTGGGGTCTTCAGGTCCGCTCGAACGATCGTTTGCTATCCTAGCAGACGTATTGTTGTGCGAGCTTCCTAACTACATTTGTA
GCTAGAGTTCACGTGGGAATTCCAACACCACGACTGGTGCCGTGACTCGGGAATAGAGTATGACCATTGTGAACAGTTTGTATGGCCTTCCAGTTTACGA
GCTACCAAGAAAAAAAGAACAAGAACAAGAAAACAAGCAACATGTGGAAAGGACAATCAATGGCACCAGCTACTCCTGCCAAGTCTGGCGGAGCTCGCAA
CGAGAGTTCAAGTCCGGACGTGTCGGAAGCACGCCTTGCAGCTGCCACCGAGCTTTCTGCGAGCTTAGAGGACGATGTGGACATCGTGCCGCCCATGATT
ACGACGATTACGAAGATAAGACGCCGGCTCCAGAGCCTGGCGCAACGACACCGGAGACGGCCACGCTACCATCGGGGCTGATCGGGGCGACCAGGTCCCT
TTCGAGGAGCCTCGCCGATGAGCTAGAAAGCGTTGCGGGACCGGAACCGGTCTATAAGGAATGTGACGATGAGACCGGGGGGCTCTAAACCTTCGGTAGC
GAGTGCAAAGCGTTCAGCATTGCTGAAGTCGCCCACCTATCAGTGGTGATACGCTAGCCGTTAAGCGCGGTTTTGTCCGCGTACACATGTCGATGCCGAA
TGATGAGTGGACGCAGCTGTTCATGCCCATCCCCAAGATACAGGCCGACTGGCCCGCGCTTGCTCAGGAACTTCAATACTCAATCAACTCGGTTTCGACT
AGCCAAGTTGTCTCGCTGCTGTTGTCGCTGGACTTCGAGAACGAGACTTACCCATCGACAATGTCGCTCCAATATTGGCGTCCTCATGAGGCCGGAGCTG
CTCTCCAGAAATGGAATAAGAAGAAGCTTAGGAAGGCATTTGATGCAGTTGGCACCAACCCTGGGAAGCAGCCTGTAAGTCGACCGACCATTCTTGATGA
AGATCCGTCTAAGATTCCTCTGCGGCAGACACCCCAGAGACTCGACCATACCCCTCCGACCAAGCATGGAGCTGACCGTGGTGCCTTTGGCACTACTGAG
GCTTCACCGTACTTTCCAGACTTGCACATGGTTACACCACGTTCGGAGAGCCGTATGCGACGTATGTAAGCTGATGACGAGGGTTCGTTCGTGTGTCGGT
GTGGTGCACGGGCCTCCAAAAGTAGTGCCGGACGTCGTCAGGTTGACAGCGATGGTTCGTCAAGTGACGATGACATTTTGGTGCGTACACTCGAAGAGGA
AGAACCTCAAGCCGCGTTGATGCGTCAGATGATCGAGCTGGCAACACCGAACGACACGGACCCGAACCTAGGATTGAAATGACGTCGCACCGACCATTGG
AACGCATCAAGCCGTTCTCGGGCTCTCGTGACAAGAGTGAGAACAGTACGCAGTGGCTCCGCGCGCTCGTCTACGAAATGACTGGAACGCACACGGACGC
TTTAGCCATTTGAGTACCTTCTATGGTACATTCCATTTGAGCTTCGTCTCCGGGACGGAGCCATGCATTGGTTCCGTCAACTTCCGAAGAAGCCGAAGCG
GAAGTGGAAGCTGCTGAGCGACGCGTTCATCCGCTACTACGGCTTGCAGTTCACGCAGACGGCACTGTCACGCTACTACTCTGCAAAGCGGGAACGCAAT
GAACATCTGTGCGACTACATAAATAGGCTAAATGGCTACGCTCGGAGTACCCATCTACACTTCGACAAGTGACGCGAATGAACACGTACAGCTGTTCCTG
GCAACGTGCGGTGATGACAAGCTGGCAGAGAGTCTCTACCACACTCAAGTCACCGACATTCACGAGCTCGAACAGATCATCGAATATGTTCTCAAGGGCA
AGGAACGAATGGCTAAGCGTGACAGTAAGTATCGACACTCCAAGCGTCGTGATGCGCGACGCGACGATGCGTACACCCGCAACAATCGACGTAATGACCG
TCGCCGTGATGACAATCGCAATAAACCAAGAGTGACGCTCATTGAAGCCTCGGTGGATGATCTACTAGCTGATCTGAAGGGTCGTGAAGCTGCTCAGGGG
GACACCAATTATTCAAATGAAGATCCGAGCACTTACGACCATGACTAAGACGAGTACAACGGCTTTCAGCCTCGCCGCGGCTAATGACATGAGCGCCGCA
CAGCCGCTGAAGGCACCTACGCACGTTCAGACAACCGTCAGACGCGTGTGAACACGCCCGATCGCGAGCGCGGCTTCAATCAAGATCGCCGAGGTGGTGA
CCGCCGGTTCAATCAGGATCAACGTGGTCGACGCCAACCGCCCTACCAGACGCCCACAGAATGGACGATGCGCGGTGTGCGGTGGCATGGGTCTCTCCGC
CCAATACGGCAAAAAGCGACACAAGGTCTGCAAGCAACGCCACGATGCTGGACAATGCGAACTTTTCCGCAATTTCCAAGACCTTGCTAAATTCGTGCGA
ACCAACGGCACGAAGAAGGAGCTCCCACCAGAGCTCAAGGCCGTCGCTCAGGAACGCCATTTAAACTAGGCAGCCCACCATCTACTAACTGGGTTGGTCC
CTATCGGGCTGCCACAGTTAGCCGAGCCTTCATGGAAGCGGAGTGTATCTTCGCTTTCATGGGGCAGAGTAAATGGTCGGATGATTATATAACAAGTGTG
AACGCAGCGGCAAATGAAAAGGAGAGGAGTAATACTCTCGGTTAGGGTGTTGGAGAAAGAATGGAGTGTGCTGATGCCGATGAGGGCACCAGCGAGGGCT
CGTTCGGCGTGGTTTTGAGTGCAACACGAGACGAGCCCAAGGGTCACTCCAAGATGATGATGGTAGAGACAGGGGTGGTGGTCGGCCAAGCAATTTGACC
GCCGGATAAAAATGAGAGCACTGGTGCAAGGCGCAGTAAGCGACAAGCGTACGAGGATTCATCTCGACACAAGAACGAATGTAAGGGTGATCACTGACAC
CTTTGCTAAGAAGTTGCGGCTCCGAGATGTACCTGATCACGGACGCCGCATTGGCATTCAAGGAATCAACGAAGGCAAGGTGTCTACGACGCGACGAGCG
TGCGTCAAGATTACGCTCGATTGGGAGATGGTGTACGAATTTGAGATGTGGGTCATGGAGCATAGTGCAGGTGTCGACGTGGTACTCGGGCCGACTTTAT
GATCCCAGCTGCGATTTGTTTGTACCTGTTTCACGGCGCGGCGCAATTGCCGCACGAGATTTAAATTCCACTGATCAAGACCAATAATATGATCGATAGT
GAGGAATATGGCTCGCATGTTAATGCCGGACCACCCGAGCGTTTGGACATTCATGCGCACGAGTGGTGAGAATATCGACTAGTGAAGCGTCAAGTTGGTC
TGGAAGAATACGCATTGTTGGTTTGTCGAGCAGAAAAGCTAATCCCGTCAGTGGCGAGGTTTCGACGTGGCCAACCTCAGAGTATTCGGTTGACTAATGT
GTCGGACCAAACTGTGTACCTACCAGCGCTCAACTCGATTGCCATGTGGATACCAGATGGAGATGTGCCGCGAGGTGACGGCTATGTGCGACTAAACACC
AGGAAGTATCAAAATTGGCAAGTGCTGACCTTCAAAGCTGCAGAGACCGCGGGCTGTTCCAGCGAGAGTGTGAGATCTACGAACAATGGTTTACAACTCA
GCCTTCGGCAGTTGAGCGACCATACTATCCAGAGCCCCGTGAGGTACTAGCACGGCCTTTTGAAGACCTTTAAATGACGAAGAAGGTCGTCGTACGTGTG
CAGGGCGCTAGAAGACGATCATAGAGGAACGAGATCGAGTGGAACCGTGTCTGACGTCTGGGGTGACAGCCGGGGACTCGAATGATGTCCAATTTTCGGA
AGTCCATTGGACACGTATATGACAGCTCACAGCGGAGGCAATAATGCGAGCGAAGACACGGCAATGCTTACCCACGACCTACCAAGCTCGGAAAACTTAG
TGCATATGCCAACGAGTGTTCGTTTCGACTCTGGGGTGACGACGGAGCTGACGAGTAATAGCACTGGATCAGATAGTTATACCAATCTAAGCGGGGTTAG
CCAGGCATTGTCCGCAGCCAAATCTGCTAACGAATTTGCGGTGATTGCTCCAGAGATTGCCGACAAAGCGATGAAGATAATGAGCATGGCACCGAGTGTT
CGCTGCGATATTGAAGCAAGGGCCGGACCGTCAAGACAGCTGTCACTCGAGAAAAACAAAAGAAGTCACCGACCCAGTATGTCGGCCGCCTACGCTTCCA
ATATTGCGAACAAGGACTCGGCCGTTGGTCCAGAGATGGGAAACCAGGCGGTGAAGGAGATGGATCCAGTGTTGAGTGCTTAAATCGAAACGGATACCGA
CGCTGAGTAAAAGGACAACGCCGTCGCAATTTTAGACGAGACATACATGCCGGTTACTCGCGTGTTGACTACCCAAGAACATGAAATGACGGAGGCTACA
AGAGTTGATTTCTATGAGCACCCAGCTTTCAAAATCGGTCTGGAAGACTACGCAAAATAATTGACCTTCCTGCCAGACCTTACCGAAGAAATCAACACAG
CGAAAGACTACAAAGCGCAAAATATTGCTGATCCCCAATTGTCGACCGATCGCTGAGAGCGTCTAGGTGCAACGCTGAAGAACCACGAGCACATCTCGAT
TGCTAGTGGTAGCGCACTGCCACCACCAGCCTACGGCGCATTATGCGATATCGACACGCAGTGGCATGCCCCAATTAAACAGCGTGCCCGATGCGTACCG
CTACGTTCTCTTGGTAAGCTGTACGAGCTGCTAAGGGCTTTATTGCGAGCAGGATTGATTGTGTTTTTAGACAGTCCATGGGCATCGCCAATCGTGATTA
TGATGAAAAAGAACGGGCTGGACATCCAGCTCTGCATTGA