Description :
From Genome Similarity Track
Location :
contig_4:129045- 135078
Transcript NameFunction/comments
g1206.t1hypothetical protein
g1207.t1OWZ19648.1 hypothetical protein PHMEG_0006078 [Phytophthora megakarya

Sequence
6033 bases(100 bases per row)
GTCGAGTGTGGAGGGGGAACAAGGGCGCAGGCAGGCAGCGCAGGCAGCGATCCAGGCAGCGTGTCGGCCCGTCGTTGCCACGTTCAGTTTGGTCCTCCCA
GATTGTGCTCGTAATTTGGTCAGGATTTGTGTCCATAATGTGTGCGGGCGATCGTTATGGCGCGATGTCAACGTTGGTCTGTATTTGTGTCAGGCCGATC
GTTATGTCGATCTCACCCATGGCAAGTGCGCCAGACGAGCACGTCGTGACGGCCGAGGACCTCCTGGAAGGGCCCAGAGCGAAGCAGTGGGTGCAGGTGG
CCGCGCGAGTGTTTCCCGAGCTGGGCACCGTCTCCAAGGCCAAGCGCGCTCGAAAAGCGGGGCATTTGCTACTTAACGAGAAGGAGATAATGTCTGTTTT
GAGTTAACTGACACCTACACCGCACGCGGCAGCTCAATGAACGCAAGGAAATGCATTTTTCACCCCAGCGACCACTGGCATTGGCCACCTGGAGGCTGTC
GGCGGCTCGACGTGGTTGACGAGACGTTGGATGAGGCCGTCGAGATTCCAGCTCGAGAAAAAGAGGCGCCCGCAGGGTATCCTTGACCTGGAATCTGCGA
TTGCGTTGGGTACGACTGGTGCATGTAGTTGCCGCCACCGCTGCTGCCGCTTCGAGTACTGCTGGCCGTACCCAGTCGCTGGTAGTCAACGCCAGGAGTT
GGTGGCGGCTGTTGCTGCTGTGCGTGCTGGTGCATGAATTTCGAGAGTGGAGACGGAGGGTTGATACTGTCATCAAACGCTCCTCCGGCAGGCCCACTGC
TCCAAGTTGATGAGGAGGTGGTCGGGCGGTCGCCGTAGTTGCTGCCGTTGCTGCTGTTCTTGCGCGCTAACCAGAGTCGTCGCTTCTTTTCCCAGTTCTG
GTCTCGCTTGGAGGACGTGAGCGGCGGTTGGGAGCCCCAGGAGCTTGAGCTCGAGCTCGAGCGGATGCTCGACCGAGAGCTCGGTGTGGGTGACGAAGAG
CGGCCGACTTGGCACCCGTTGGTGGTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGGTTGCTGGCAGTGTGTGCGGTCTGGTACTGGTATGGTT
GCTGTTGCTGGTACATTTGCTGCGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAGCTCGGATAGCCATTGCCCGGTGC
GTTGCCATTGTTATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCC
GGCTCTGCTGTGCCGAGTCCACCACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGG
AGGCACCACCAGGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGT
TGCCTGGCTTCTTCTTCTTACTGGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATTTATATCG
CAGTGCCTTGCGCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCT
TCTCAAGTTCCTGCTCGCCATAGCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAG
TTGCAGGCAGTGCATCCTCAGTCCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGGCATATCC
CTTTAATACGATCGACAAGTATGATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAG
TTTGAAGTCTTCAGTGACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAAC
CCCCGCAAGAAGAGCAGTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCGACAGATA
CCAGCTCCGCTGAAGAAGGTGAATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAGGAGTGAT
GGCTGGTGAGGCTACTGACATTGATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGC
GCAAAGGCTTCAGCAACTCGAGGATCATCTTAGCGCTCGAAAAACTATTGACAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATCAGCCACC
GGTTCCGATAGCTGGAAGACACTGCAAAAGTTGGCGCCAGCTCAACACGAAATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTAC
CAAAGGCCCAGCTTGAGCTCGTGCAGTTCGCCAAGCGATATGACAAGCTCATCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCA
GCTTGTTCGAAGCATGCAGCAGCAGCAGCAAAAACATGTTCCTCGCACTGACGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTCGTCAGAC
CCTACAAGCATGTAAAAAGTAAAAAGTAATATCTGTGAAGCCACATTTCGTTCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTG
GTAGCAACAAGCACGAGCTTGTGCTTCGCGACAAATCCAGCAACATCAAAATTCGAGCGCTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTC
CTTCCTGGCGGAAAAGCAGCGAGACGTAGCGGTGTTCCCCCACGGGTGGTGTCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGTCTTGAAC
ACTCTGCCCGTCCACAGCTAGGCCCGCCAAGATATAGTGCAGGAACGGCGCGTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAGCACGTAC
GTGTAGCGCCCAGCACTGCCAGCTGGGTTGCCTTCAATAGAGACACTCGGTGCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACTTGCACTT
CGTCCAACGGATTAAAAGGTAAAAGATCTGGTGGTGCCAACCTCCTTCATGGGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAACGCGATAG
CGATGTGGGCACTGCTCCCGTCCTGGATTTGGAGCTGCAGCTGCTGCAGAACTTGCACGGGGACAGAGACGGTGTCCATTTCGGCTGCGAGGCGAAGCGT
CGTCACAGATCCGTCCTCATTTCGGAGCTGGTGGGAGGCAACCCCCACGGACTGCATGACAGCCCCCATCAGCGCCATACTCACGAGAAAAGCGGTCGCG
ACGAGGACACCCGCCCCGCGCAGCGAGAACGAGGCAGGTGCCAAGAGCGGCGGCGGGAGCTTGGAGCCGTACGACATCTTTTGAAGAGCTAACCGGAAAT
GCGCGTGCGACCGTTAGTTTTACCTGAGTTGAGTATGTTTTGTGTCGAGACCACCTCAAGTGCATTATTTTTGCTTACGTCTACGCTACTGTTAGTTAGT
TGACAGCCTCGTGCTTTCTGGCCCGGGCGTCGATGACCGCAAGCCATCGCTGTGTGGCCATTGTGCGGGGCGTGCTTTTTTGAGTGCGTCGCTGGCGTTT
CTCGACGAATGCGTTGGCAGCGAGACGGCTTTCGGGGGACATGATGTCGTCCCAAGCACGTGTTCGCCCGGTGGTTTTTGCAGGCGGCTCGATGATCTCC
ATGTCCAGAGCAGGTGGAGAGTGTCGCTCCGGCTCATGCACGCTCTGCGTGACATAGATCTCTTCCGGCTCCGTCTTGTGCGGCGAAGGAAGTGCTGCGA
CAGAGTAATTTCTTGTGTTGTCGTTGCCCGTCTGGTTGGAGTGACTGCGGTGCTCATAAGGACGGCGAGCAGGGTCATCGAGAACAGGATAGTCAAGGTG
ATCGGCATGCCGTGTCGGGGAGGGCTCTCTTACTTCATAAGCAGCTTGGTTGTCGTAGTCATGATCACGGTCCTTCCAGGTGTAGCGTTGGCGTTGGAAG
TCATCCCGGCGGTGCATCTGGTGCGGTGAGCTGCTTGGTGTTGTCAATCTGGGAGATGGCAAAATACTCTTAGATTCTCGGCTGTGACGCATGTAGTCAG
CGTTGTAGTCAAAGTCTTGCTTTCGATACCCTCGCGACGCCGAAGAGTGTGTGGGGCTCGGAGCAGCACGAATGGGGCTTCTGCTCATGGAACTAGATTT
GCTCGGCGCTGCGGTATACTCGGAGCGATGCCAAGGGGAGACAGCGCGATTTTGACTCGGGTGTTTGCTGACGTAGCCTCCTCGAGACGGTGGTTCATAA
TGCGGTTGTTGCTGTTCACGGACGCGTTGGTGGCTGTGGTGGCGTCGCCGAGTGTGACTGTGTTGCTGCTGCTCAGGACGCGGAGGCAGGCCGTATGCGT
CCAGTTCGCGACATTGCTCGCGCGGGTAGCGAGAATAGCGCTGCCGGTTGCGATCACCGTGGCTACTACTGCCGGGTCCGTACGAAGTTGAGGGAGGGTA
GTATCGGTCGTCTTGCTGCGATGGGACAAGGTACGCTGACGGATCGATGTGCGTGTGCAGGCGCACAGGGTAAGTGGGCTGCGTTGGGTTACTGCGCCGC
GTGATAGGTCCACGGGAGCTCGAGCTCACGAGGACGTCTTCATCGTCGCCGCAACTGCTGATATCGTACGCGGTAACCTCCACGGGCTGTCGAAGCAGGC
GATCCGAGTCGCACGCGTATTCGTCGTCCAAGTCGTAATCTGGGCCTTGGCGTACCATCTTAGCCCGTAGCCGCTCTTGGATCAGGGCCTTCAGAGGGGT
TGACATACTGCGAGCTCTCTCGCGATGAACGGCACTTTAAGTCGCAGAGGACTGGATCGACGATGGCCGGGAAGAAAGGGAATGAAGCTCCAGTCACTGT
GGGGTTCTCCTGCTTGTGCGCTCTCTGGGTTGCCGAGCTGGGATTGTGCGTGGCCAGCAGAACTATATGTGGCGCCGACAGAGTCTGTGGGCCATTTTGG
GCGGGCGGTTTTCGGTTTTCAGGCTGCGAATAGCCCTCATCCAGCTTTTTATGGCCCTGTAAACGTTTCTTGTCATAGTCATTTCTGCTGGCGTTGCCCC
GCACCAAGACAGCGATCAGATTGGCACGCTCGCCGACTAATTAACTGACGGCCGAGGCTAGTTTCACAGTTCGTATGATGCCTATGTTTCGCGCCGTTCT
TAGTTGGTTTCTCCTTCTTGGAATGAAAATGTATGTGACTATTCCAGGCCGAAAGTTAAACACCGAGGGTCACCGGCGTCCTCGTGGTGTGTGCTCCAGG
CCGAAACGTGAGTCGATTCTAAATCAACAGTCTGTAAAATGGTGATTGATACCCGGGCGCTATTTAAGCTCCCATTCTCCGACGTCAGGCGTGTACAACA
AAGGCAGAAACCCGATACGTTGGCTATTATTCTCATGTGATGAACTTTCGTGTGTTCACAAAGTGTAGAAAAAGTGTAAAGCTCTAGCGAGGGAGCTGGC
CTTGCCCCCGAGGAATTCTTGTCGTGATGTATGGGAAAGTCTGTCCGTGGGTCTGCTTCTTAGCTGCGTGCTCAATCCTATGTTCTTTCCTCTTCAAAGC
ACTTCAACATCACTGACCAATTATAGTAGAGCCGCCTTTGGCCTGTTGAGGACAATGCGGGCGGAGCCTTGTCGGCATTTAAGAGGGAGAATGGCTCAGC
CGACTCGGTTTGACTGTGGCCAACTTCGGAGAT