Description :
From Genome Similarity Track
Location :
contig_4:129043- 135077
Transcript NameFunction/comments
g1302.t1hypothetical protein
g1303.t1OWZ19648.1 hypothetical protein PHMEG_0006078 [Phytophthora megakarya

Sequence
6034 bases(100 bases per row)
ATCATCAGTCGAGTGTGGAGGGGGAACAAGGGCGCAGGCAGGCAGCGCAGGCAGCGATCCAGGCAGCGTGTCCGCCCGTCGTTGCCACGTTCAGTTTGGT
CCTCCCAGATTGTGCTCGTAATTTGGTCAGGATTTGTGTCCATAATGTGTACGGGCGATCGTTATGGCGCGATGTCAACGTTGGTCTGTATTTGTGTCAG
GCCGATCGTTATGTCGATCTCACCCATGGCAAGTGCGCCAGACGAGCACGTCGTGACGGCCGAGGACCTCCTGGAAGGGCCCAGAGCGAAGCAGTGGGTG
CAGGTGGCCGCGCGAGTGTTTCCCGAGCTGGACACCATCTCCAAGGCCAAGCGCGCTCGAAAAGCGGGGCATTTGCTACTTAACGAGAAGGAGATAATGT
CTGTTTTGAGTTAACTGACAGCTACACCGCACGCGGCAGCTCAATGAACGCAAGGAAATGCATTTTTCACCCCAGCGACCACTGGCATTGGCCACCTGGA
GGCTGTCGGCGGCTCGACGTGGTTGACGAGACGTTGGATGAGGCCGTCGAGATTCCAGCTCGAGAAAAAGAGGCGCCCGCAGGGTATCCTTGACCTGGAA
TCCGCGATTGCGTTGGGTACGACTGGTGCATGTAGTTGCCGCCACCGCTGCTGCCGCTTCGAGTACTGCTGGCCGTACCCAGTCGCTGGTAGTCAACGCC
AGGAGTTGGTGGCGGCTGTTGCTGCTGTGCGTGCTGGTGCATGAATTTCGAGAGTGGAGACGGAGGGTTGATACTGTCATCAAACGCTCCTCCGGCAGGC
CCACTGCTCCAAGTTGATGAGGAGGTGGTCGGACGGTCGCCGTAGTTGCTGCCGTTGCTGCTGTTCTTGCGCGCTAACCAGAGTCGTCGCTTCTTTTCCC
AGTTCTGGTCTCGCTTGGAGGACGTGAGCGGCGGTTGGGAGCCCCAGGAGCTTGAGCTCGAGCTCGAGCGGGTGCTCGACCGAGAGCTCGGTGTGGGTGA
CGAAGAGCGGCCGACTTGGCACCCGTTGGTGGTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGGTTGCTGGCAGTGTGTGCGGTCTGGTACTGG
TATGGTTGCTGTTGCTGGTACATTTGCTGCGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCTGCATAGAGGAGTAACTCGGATAGCCATTGC
CCGGTGCGTTGCCATTGTTATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGTGTATGCGGGCTCCTCCTTGCTGGGCGCTTC
TTCTGCCGGCTCTGCTGTGCCGAGTCCACCACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAACCTGAGGCACGTACGCACTCACCGAAGGAG
AGACTGGAGGCACCACCAGGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATGTGAGCGTCGACATGGTTCAGGCAGTACTCG
GTTGTGTTGCCTGGCTTCTTCTTCTTACTGGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCTCGATTTACTCGGGAGCGCAGGCATCATATT
TATATCGCAGTGCCTTGCGCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTGGGAGATGCGATCTGCAGCGCTTGCACAAGT
TTTTGCTTCTCAAGTTCCTGCTCGCCATAGCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCAGTATAATGACGACTGTGGAGACCCTGCCAA
AGCGAAGTTGCAGGCAGTGCATCCTCAGTCCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTACGGCGCACGGCAGTATCGATCAGCCACCCGG
CATATCCCTTTAATACGATCGACAAGTATGATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCTCTGAAGCGTTGGATGCACGTCTTAATCGGC
TGACAAGTTTGAAGTCTTCAGTGACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGATCATTCCACCTCCGCCAGCGGTGCCTCCTCC
TGATAACCCCCGCAAGAAGAGCAGTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAAGTCACAAACGAAATTGACCAGCTGATGGCG
ACAGATACCAGCTCCGCTGAAGAAGGTGAATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGCGATTGGTACGGACGCGCATATAAAAGGAAG
GAGTGATGGCTGGTGAGGCTACTGACATTGATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCGGGACACCGTTCGTATTGCTAGTGCGCAAGA
AGGTTGCGCAAAGGCTTCAGCAACTCGAGGATCATCTTAGCGCTCGAAAAACTATTGACAAACACGTGGAAAGCAGCAGCGGCAATAACAACGACCCATC
AGCCACCGGTTCCGATAGCTGGAAGACACTGCAAAAGTTGGCGCCAGCTCAACACGAAATGCTACAGAATCTGCTCCGTTTGCCTGAGAAACAGCTACTG
AAGCTACCAAAGGCCCAGCTTGAGCTCGTGCAGTTCGCCAAGCGATATGACAAGCTCATCAAGGCTACACCCGACCAGCTTCGCCATCTGCCGATTGAGC
ACCAGCAGCTTGTTCGAAGCATGCAGCAGCAGCAGCAAAAACATGTTCCTCGCACTGACGAATGCAGTTAATATGGAAATTAACGCTTAGCTAAAACTTC
GTCAGACCCTACAAGCATGTAAAAAGTAAAAAGTAATATCTGTGAAGCCACATTTCGTTCATTTCTGTCAGTTGTCTTGGCCAGCCGGGTGCGAATGAAA
GCTGCTGGTAGCAACAAGCACGAGCTTGTGCTTCGCGACAAATCCAGCAACATCAAAATTCGAGCGTTTTTCAGTTAGGTCGTCATCCGGCGCATCGGGA
GCACTTCCTTCCTGGCGGAAAAGCAGCGAGACGTAGCGGTGTTCCCCCACGGGTGGTGTCACCGGGTAGTACGGCACTACTACTACGTTTTGCGGCTGGT
CTTGAACACTCTGCCCGTCCACAGCTAGGCCCGCCAAGATGTAGTGCAGGAACGGCGCGTGCGTCGGAGACTTGGGATCCGGAGCATCAATGTCGATCAG
CACGTACGTGTAGCGCCCAGCACTGCCAGCTGGGCTGCCTTCAATAGAGACACTCGGTGCTTCTTGAGCCTAGCAGTCAAGACGAGCATGATGTGAGACT
TGCACTTCGTCCAACGGATTAAAAGGTAAAAGATCTGGTGGTGCCAACCTCCTTCATGGGCACAAATTGCCCCAGGGTCACGGGGTGGCCGCCATTGAAC
GCGATAGCGATATGGGCACTGCTCCCGTCCTGGATTTGGAGCTGCAGCTGCTGCAGAACTTGCACGGGGACAGAGTCGGTGTCCATTTCGGCTGCGAGGC
GAAGCGTCGTCACAGATCCGTCCTCATTTCGGAGCTGGTGGGAGGCAACCCCCACGGACTGCATGACAGCCCCCATCAGCGCCATACTCACGAGAAAAGC
GGTCGCGACGAGGACACCCGCCCCGCGCAGCGAGAACGAGGCAGGTGCCAAGAGCGGCGGCGGGAGCTTGGAGCCGTACGACATCTTTTGAAGAGCTAAC
CGGAAATGCGCGTGCGACCGTTAGTTTTACCTGAGTTGAGTATGTTTTGTGTCGAGACCACCTCAAGTGCATTATTTTTGCTTACGTCTACGCTACTATT
AGTTAATTGACAGCCTCGTGCTTTCTGGCCCGGGCGTCGATGACCGCAAGCCATCGCTGTGTGGCCATTGTGCGGGGCGTGCTTTTTTGAGTGCGTCGCT
GGCGTTTCTCGACGAATGCGTTGGCAGCGAGACGGCTTTCGGGGGACATGATGTCGTCCCAAGCACGTGTCCGCCCGGTGGCTTTTGCAGGCGGCTCGAT
GATCTCCATGTCCAGAGCAGGTGGAGAGTGTCGCTCCGGCTCATGCACGCTCTGCGTGACATAGATCTCTTCCGGCTCCGTCTTGTGCGGCGAAGGAAGT
GCTGCGACAGAGTAATTTCTTGTGTTGTCGTTGCCCGTCTGGTTGGAGTGACTGCGGTGCTCATAAGGACGGCGAGCAGGGTCATCGAGAACAGGATAGT
CAAGGTGATCGGCATGCCGTGTCGGGGAGGGCTCTCTTACTTCATAAGCAGCTTGGTTGTCGTAGTCATGATCACGGTCCTTCCAGGTGTAGCGTTGGCG
TTGGAAGTCATCCCGGCGGTGCATCTGGTGCGGTGAGCTGCTTGGTGTTGTCAATCTGGGAGATGGCAAAATACTCTTAGATTCTCGGCTGTGACGCATG
TAGTCAGCGTTGTAGTCAAAGTCTTGCTTTCGATACCCTCGCGACGCCGAAGAGTGTGTGGGGCTCGGAGCAGCACGAATGGGGCTTCTGCTCATGGAAC
TAGATTTGCTCGGCGCTGCGGTATACTCGGAGCGATGCCAAGGGGAGACAGCGCGATTTTGACTCGGGTGTTTGCTGACGTAGCCTCCTCGAGACGGTGG
TTCATAATGCGGTTGTTGCTGTTCACGGACGCGTTGGTGGCTGTGGTGGCGTCGCCGAGTGTGACTGTGTTGCTGCTGCTCAGGACGCGGAGGCAGGCCG
TATGCGTCCAGTTCGCGACATTGCTCGCGCGGGTAGCGAGAATAGCGCTGCCGGTTGCGATCACCGTGGCTACTACTGCCGGGTCCGTACGAAGTTGAGG
GAGGGTAGTATCGGTCGTCTTGCTGCGATGGGACAAGGTACGCTGACGGATCGATGTGCGTGTGCAGGCGCACAGGGTAAGTGGGCTGCGTTGGGTTACT
GCGCCGCGTGATAGGTCCACGGGAGCTCGAGCTCACGAGGACGTCTTCATCGTCGCCGCGACTGCTGATATCGTACGCGGTAACCTCCACGGGCTGTCGA
AGCAGGCGATCCGAGTCGCACGCGTATTCGTCGTCCAAGTCGTAATCTGGGCCTTGGCGTACCATCTTAGCCCGTAGCCGCTCTTGGATCAGGGCCTTCA
GAGGGGTTGACATACTGCGAGCTCTCTCGCGATGAACGGCACTTTAAGTCGCAGAGGACTGGATCGACGATGGCCGGGAAGAAAGGGAATGAAGCTCCAG
TCACTGTGGGGTTCTCCTGCTTGTGCGCTCTCTGGGTTGCCGAGCTGGGATTGTGCGTGGCCAGCAGAACTATATGTGGCGCCGACAGAGTCTGTGGGCC
ATTTTGGGCGGGCGGTTTTCGGTTTTCAGGCTGCGAATAGCCCTCATCCAGCTTTTTATGGCCCTGTAAACGTTTCTTGTCATAGTCATTTCTGCTGGCG
TTGCCCCGCACCAAGACAGCGATCAGATTGGCACGCTCGCCGACTAATTAACTGACGGCCGAGGCTAGTTTCACAGTTCGTATGATGCCTATGTTTCGCG
CCGTTCTTAGTTGGTTTCTCCTTCTTGGAATGAAAATGTATGTGACTATTCCAGGCCGAAAGTTAAACACCGAGGGTCACCGGCGTCCTCGTGGTGTGTG
CTCCAGGCCGAAACGTGAGTCGATTCTAAATCAACAGTCTGTAAAATGGTGATTGATACCCGGGCGCTATTTAAGCTCCCATTCTCCGATGTCAGGCGTG
TACAACAAAGGCAGAAACACGATACGTTGGCTATTATTCTCATGTGATGAACTTTCGTGTGTTCACAAAGTGTAGAAAAAGTGTAAAGCTCTAGCGAGGG
AGCTGGCCTTGCCCCCGAGGAATTCTTGTCGTGATGTATGGGAAAGTCTGTCCGTGGGTCTGCTTCTTAGCTGCGTGCTCAATCCTATGTTCTTTCCTCT
TCAAAGCACTTCAACATCACTGACCAATTATAGTAGAGCCGCCTTTGGCCTGTTGAGGACAATGCGGGCGGAGCCTTGTCGGCATTTAAGAGGGAGAATG
GCTCAGCCGACTCGGTTTGACTGTGGCCAACTTC