Description :
From Genome Similarity Track
Location :
scaffold_418:12904- 19603
Transcript NameFunction/comments
Pl_105043glycosyltransferase
Pl_105044hypothetical protein PHYSODRAFT_333395

Sequence
6699 bases(100 bases per row)
AACACAGGCTCGAATACGTCGCCCGAACTCTGGATATCGTACTGCAGAATGGCAGCCTCCTTGTCATCCACAAGATCACCCTCGCGGAACGAGTTAACGA
TCTCATTCCATACCACCACGAAGCGCAGCATCATCTGCGACTGGTATGCGGCGGCCGAACCATCGGCGGCAGCGTCATTGGAACGGGCAAGGTTGGTCAC
CACCTTCTGATCAAAGAGCTGGGGAGCCACACGGAAAGCCTTCGTGATCTCCTTGATGCCGTGGATTTCACCCGTCTTCATGATGAGACCCTGAAGGCCA
CCAAGTGTGGCCTGGAACACCGTAAAGTAAATCTGGGTGTCGTAGTTGAAAATGAAAATCACGGGCAACCACAGCGCAGCGATGACACCAAAGTTGTGGA
ACGACACGACATTGCTACCGTATTCCAGCTCCATCTCGTAGATAGCGAGAGATGGAAGGACCAACGGACGGACCAAAATGAAGTACGACACGAACGCCTT
CAACGCCCATAGCACGAGCCAGAAGGTGATGTACTTCATCTGGTAGCTAAGAGGAGGTGCCATGTTACGCCCAACATAGCACGTCTCACCCTCACGGATG
AACTTCGCTGCGAATGTCTTGGTAATCATTGTTGGGGAGAATGCCTGAATGACGATGATCAATGCGCCAGGAAGAATGTAGGCTACCGACGCAGGCGCAG
CCTTGTCAAGCAACTCTGTGTTCTTGCTTGTGATCAACGGAGTGTAAATCATCAAACCGAAGATGCCGGCAAAGGCGCCATTCCAGAGCATACGAAGCAC
CAGAGCACCACCATAGTTGAACGAACGCGAAGACGTCTCGGATGACTCACTAGCAGTCAACAAGTGCCAGCCGTGGCACGCTTCCAGTACCGTCTTGCAG
AATCCCATCGACGACAGTGCAAACACAATACCGACGTACGTCAGTTTGACATCCTGCTTCTGGTAAGGCTCGACAACTTCACCCATGGATCCAAACTGTG
CGAACCACTGCTGTCCTCCACTGGGCGAAATGGCTGAAATGAAAGCGATTGCCATGAGCACCATCATGAACATCATGTTGAACTGGAAAATTCGGTAGTA
GTTAAGCACAAGTGTGAAAATACTACGATGTTCGTAGTACGTCTTGGTGTGTTTCTTGGTCAACTCGTCTCCAATCTGTGTGATATCAATGTTGAGGCAG
TACTTTTTCCAAAAGTACTCGTTAATATCGTCGTAATTCCGTACTTGAGTGTGTTCCAAGTTCTTGCCAAGACTGTTCTTCCTCTGCATGTTCGATGCCT
CTTTCCAGATCGGCCGCACCACCTGTCTCAAATACCATCCTTCCGGTACTTTTTGTTGTCCAAGGAAGTCCTGATTGAGCATATTCAACGATTGATGGTA
CAAGTAACACAGACTCTCTGGCATGTGGCGCAAGTTACCAGCTTCTCCCCAGAGGAGCAAGAAGAGCATAATGTCCATATGCAGTGGGTTCTTGAGGTCT
CCTTGTGGCTGCCCACAGTACGTGACACTCGAAACACCAATGAATTGACACCATTCCGTGTAATTGCTCATGAGTTTCTTGTGCAACGTCACGACGTGAT
GTCCTGGTGGGTCCTGGGGCTTAGAGCGAGCCTTGGAATTGGCCAATAGCAGCAGCACATGCTCTCGCTGGTTGTCCACACTCCCCGATTGGAAGCCAAA
CTTGTTGTACAGCACTTCACAGCAAAAGTCAATGGATACTTCATCTGCAAAGTCGCCTTCCAAGCCTCCTCCACGCAATTGATTGCCGCCTTGGGTGTTG
GGCGGAAGGACGTCCATCATGCTCAGACGATCGCCAAACGTCCCGCGGTTGTCGCCATAGTTGCTGCGGTTGTTGGACGTGTTGCGCTTGCGGTCTGCGT
CCAGTTGAAAGTAGTTGGAACCAGCTCGACGGCGGTCCATCTTGCCTCCGGGCGTTGTGGCCATCGCTGCAAGAGTGATGGTCACCCGTCCACACTCGAC
CCTGTTTGGTTGTGAGGAGTGCGGAATCGAGGGGGGACGAGCGCTTGACCTTGTTTCTGACTCGCTGACGTTGACCAATCAGAAGCCACAGCCCAGAAAC
GGCGAGATCCCTAACCACAGAGCCAGCTCTCGATTAAGTTGATTGTAAGGAAATGGCTACATTTCAGTCGTCTCTTTTGTCGTTGTGCGGTACAGGTGTC
GCGTTGTGTACGATGCACTACACTGTGACATTGCAGACAGATGTGGCAGCCCCGATGGGACGCGCAAATCCATTTTATCAGGTACGAACGAAAGTGACAG
GGAGTAAAGTAAACGGGAGATGGACGCCTGGTTTTGTCGATTTTTCCGGCTCTCTGTTCAGACGATCTTACGACGTCGGTCTCGCGCAATGATCGACTTG
CTCGTGTATTTGAGCTCGGCCCCACGCACGAAATTCAGCTTGGACAGGCTCCAGTTGCACTGTAGAAGACCGGCGGACGACGACCGAGAAGTGACCCATC
GTGACGAGGGGTCCGATCTTGGTTAACGGACCACTATGCCGTTTCTACAGGGTTGGTCTGATACTTTTTGCCTCAGTGCTGGAGTTGATACAAATCGTCT
TCATCGAAATTAGCGTTATCGCCGCGATGCACTTGCTCCAAAAATGGACTTCTCATCTCCACAAATCGTTGATATTGGCTAGAAAATATTGGTAGTAAAC
TATCAGCGACAGCTTTGACATACATGCAACTGAGTGGTTCGATGGAAGATGCAAGAACAGATTGTCTTGTGCGAATTTGTTGGTAGTTTAGAAGCTTGAC
CCGAGCCTGAAGGTGTTGAAAATCAGTGGTACACCAATTCGAAGTGTAATAACTCAATCCGTACCGACAACTTGCACTCAAGAGGTTCATTGCAGAGACT
TTCGGTGATGCTCGGTTGGTAAAACATCGTGACTGGTTCAATATTGAGTCTACAGGCATGAGCGTTAATGCCTGCCATGTGCTGCATCTATCGTCAACAA
CCAGGGTCCAAAATCGTCGATGTGTATGCAATGTGCTGCATCTATCGTCAACAACCAGGGTCCAAAATCGTCGATGTGTATGCAAAGGGCTCGATTGATT
TGGGTGGTGGCATGCCAGCTTTCGTTACTAGCAGTGCTTCATGTGCGATGATGTTTTCAATGGCGATGTCAATGGAAAGCGCTGAAGCGAAGCGTCTGAC
AAAGCTCGCTCTTGAACACGCAGAGAAACGAGTCAAGGAGAAGGAGAATAACAAGTTTGAAGTCGAAATTGAGGCTGCTGTGGAGAGATCGCAAAAGGAC
ACAACGGATTCCGTCATCGATTTGTTGGCGGCGTCCATGATTTCCTCTTCTACCGCTTCTTCAAATGAAGACAAGATTAAGACATCAAAAACATCTCGAG
AACCATGTCACGTCTGTGGTAAAAAGCCTGCAATGCCCAAACTCGTCCGATCATCGCACCGCAAATGTGGCATCTGTAAACAACGAGCATGCAGCAAGTG
TAACATCAAGCGAAAATTGTTCGGCCAGTCCGGTCCTGTGACGATTTCGTGTTGCAAAGTTTGCATTCTCGAGTCCAAGCGTCTCAGCATAGACCCACGT
GATCCATGTCCAATTCTGCCGTGATTTTGTCTGTAAGATTGACGAGGATACAGCGTTTCGTAATAAAGTTCTTGTCCACATTACCAAGTGCTCACACCTT
GTTTCTTGTATTACGTTTTTAAGCTGCAAATTTGAAGACCTTCTGCGGCTACTTTCCGTGCATTTGTGTCATTGGACATGAAAACAACAAACAAGTACTG
CTTAAACATTCTTCAAACGATTCACTTTTACTGAGGTATGGAAAGAACTATCCTCCTCTCGCCAGCAAAACCATTCTTAGGACACGTTTAACTATCCTTT
GAGTGGAAGTCCTACACGTACTTCTTGTAGACCAACTTCTCGGGATTATTAGCTGCCATCCCCTTTATCCCCAGCCACTTGTAGACGTCACTCGGCTCTG
TTTTAGCTTTCAGCCATTTCTTTAGCAGCAACCTTTGTAGCAATGTGGCGCGCTGTCGTGTGTGAGATGCTTCCTTGCCTGTGACCAACATCTTTGCCAG
CTCTGCATCATTGTAGTGTTTTGATAATATCTGGAACATCGCAAGAAGTGTCATTTGCTTTGAATTCAAGAGGCGATAATAGAGCATTGGACGTTCCCCC
GTCCAGCAGTTTGGCAACTTCAGCAGGGGATTTTAACTCACGCACCCACGTGTTGAGCAGCGGCATCTGCAAGCTTGAAGCTAGTTCTTTCGTGAACGGG
TTCTTCTCTGCTTTTGCGAGCATTTTTGCCACATCTTCGTCGCTATAGTGAGTGAGGAATGTCCGGAGCATATTCGTTTTCTTGTCGGGATATTTTTTGT
TGAAATCATCGAGAAACTTCGCCCACACTCGAAAATCTCGGTGTGCCAGGATGTTACTTCCACCAGGAATATTTTGTAAATGTAACAATTGAAAAACATC
GACCGGAAGTTTGTTCCACCGCAACCATGCTTTAACCAACTGAGCCTGGATGATTTTGGCGATTTTTCCAGAATGCGGATGCTGCTGTGTCATTTTGATC
ATTTCCATGATATTAATGTGGTGGTATCCGAGTCTGATCAGTATATCGATCGCACTCTCTTGCCTGCTGGGGTTCTGTTTGTTGAACATTGCCACGTACT
TGAACCATGTTGTGAATTCAGGGATGGTAAAAACCATCTTCCATCCTTCGTCACTACTTAAATCAAGCCCCATAACCTTGTAAATACTATCAGGAGTTTT
TCCCTTCTCCAACCAGCCACGCATCTGATCTGCTTGTAATTTAGTAGCAAGAGTTTTGGTTTGCTCGACCTTCTTCGCTGCCTCAAGCATCTGAGCAAGA
ACTTTGTCATCGTAGTGAGCCGCCAATGTTGCGATCATCGACACCGGTTTTTCGGGGTTCTTTGCGTTGAAGTCCTCCACGTTCTTGACCCAAGCGATGA
ATTGCGGATTGTCAAACAATTTATCCCCTACTTGAGTCTGCTTTAAAGTCGTGAATATGTCGTCAACGGATTTCGCGCTATTGACCAAGGTTCTTTGGAC
GAGAACAAGGTTGTGGCTTTCTCGACGCCCGAGACTGATACTCCTGTTCTTTCTTCGCTTGTGGCCCAATTCTTAAGAACCGTTCAGACTGGATGGCATT
CGGGGAAAAGTGACCAGCGTGGATGTTGATCTCCTCCGATCCCGCTGAGAACCTTCCAAGACTTGATATGACGACAACTAGTAGTGTTGCGAAGAGTAGA
CGCATGATTAGTAGTTGGTGGAAGTGAGCAAATTGTGATGTAAAGCTATTTGTCGGGAGTCACAACTCCTGATTATGTTTTTCATAGGATTATGTTCCAT
AGCGCTTTACTTTAGGAACTTATGAGATGCAGAGCAGAAACATAGTTTGACGAGGCCAATGTGGCAAACATTCTGGAGCCCGTGTGGAGATTGCCATTCC
GAGTCAATTTGAATTGGGAGATATAGCTTTACCGTCTCATAGGGATGTCGCTCGTAACAGCTTCAGCGCTGATAGGATCAAATGAATATAGGAAGTAGAA
GTTGTAGACGGGAGTAAAACTCTGAATGAATTATTACTTGACCATGCCTGTACTGCGTGTCTTACCAAGCGCATACGTACGAGGAGAAAAACATCACGCT
TAATTTGAAAGTTTTCAAATGAAAACCTCCTGGAATCTTCTTTTATAGCAATACTGAGGTTAAGGATTTCCTGCGCCAAACCATTTTGTGACGTACAAAA
GTTCGTTGTATCACCCCTGTGTTTGTGGGAAACGAGCTAAACGTTTCAGTACTTTGTGAATTCTCTACGTTCGAGTCTTGCTCGTTTGTTTTTCTGTTGC
CATTTTGTCAGTGAAAAGAATGCTACCAAAAGGATAAAGGCATCATGAAAATTTATTGAAAATAGAAAATAACACCATCATAACGTGAGGGAAGTAAGTC
AATTTCTAGACTACGAACTATGCTTATCGACTCATAACACCTTTGACTCACTCACACACCTATTAAAGACACAAATTACTGCTTCCGGTCTTGTTCTCGT
TAATTTTGCTGCCGTGACCGGAATTCCGCTCTTCGATCGCATCGTGCCGTAGTGCTTCGAGCATCGAACGACTACGTAAACCTGCAACTACATAAATCTA
GGCACCGCATCAACAGTGGACTTCATAATCAAGCAATGGTTGGTGCTAAGGAATTACTGAGCGCTGTCATAAGGCATGCCCGTCTTAGGAAGCAGGACTA
CGGAAATTAGGTCGCATGTCTAATGAACTCACTTCACAATCTGTTATCAATAATATACTAAGTAACGCGCAATATGTCATAACCATGAAGATTACGGGTT
CGAGTCGAACACACAATCTTTCTGGTTTGAATCGTGGTAGGGATTTGAGATTTTGCGAAGTACTCACTTCACAACTTGCTCAAACATTTTTCTACAACAG
AAAAATGCGATATATCTGTATCATAGTATTGACTATCCTTGCCTTCATGGCAAATGCGAAAGTTGTATCAACGAGAACGATGGGGATCTACGAGTCACTG
AACAACGAAGAGAGGGCGAGCAATCTCCCTGGTGGGCCTATTACCACCAGATGGCTAAATCGAATATCGTCCAAGATCAGCGACAACGTTCATGCCCGA