Description :
From Genome Similarity Track
Location :
Scaffold_542:12901- 16712
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_542-abinit-gene-0.28Conserved gene of unknown function

Sequence
3811 bases(100 bases per row)
CGCTTCTCCCGACTCGAGTGACGACACACTCGACTGGATGATACGTTGGTGGTAACTGCGCTGTAATGCAATCTGAGGGGCAAGTGGAATAATCGCACGG
TGTTAGTGTCTTGTTGGTGGCGATATATCCCTGTGAACTTGCCATACTACGTACCACCGAGGCCATCAACTCGCCCGACTCGAGCGAGCCAGCACTGCTT
CGTACAGCATCGCCACTGGCAACCGACTTCGACATGTCGACGACGCGTGCGTTTTTGGCGCGTACAATCTTGCGTCGTGTGGCGCCAAACATTTCGCCGT
CGCTCAGATCGTCAGACTTCGTCGGGTTGAGAATGATCTCGCCCTCAGAGAGATCGGCCTCTTGGTCCAACGAGCCGTTGACACTGCTGGATGCGACCGA
TTGGTTCCTATATCCTCGCCGTCGTCCAAGCCGCTGTTGTCGCCGTTGAGCCGCATACCGCCAGACGTCGTCGCCGGTGTGCTCTCGGAAAAGCTGGGGA
CTGGCACTCAGACTACTACCGTAGCTGGAGGAAACGTCACTCGATGACGCAGGCAAAGAGGAAGTAAGACTGTGGCCAAGTCTGCTCGGTGTGATGGGGC
CTACAGCAGCGTGCAAGCGAACCTCTCGTACAGGAAGAGGTGGCGATACCATCTCGACAGGATCCACCATTGGCGCATTCGTGGTTTCCGAAAGTTCATC
TCGCTTGTCTTCGATATACAATGGCTTGACTTTGTGTGCGTTGCATATCTCGCTGCTCGTCGGGAATCGAGTTGTTGGTAGGAAGGTCTCCTGCTCACCC
ATCGACGCGGAGGCGACTGAATTCCCAACGCTCTCGAAGCTGACTGCGACCGGTATGGTTGCCTGGCGACGGCGACGCTGGCGACGCAGCGTCGCGAGTA
CTTCTTTTGTTCTGGACCCGTGCGCTTGAGGGCATCGCTCGGTCTGTAGATCCGTCCTTGTACTCGCGAGCAGGGCGCGGCCCAACGTAGTACGTGCTGC
AGGCGAAGCCACCGGCTCGTCAGCTCGCGATGATGTGGAGGGGATTTCTTCAACAAGGTCTTCGAGAGGAGGAGGTGGTGGAGGAGGAGGAGACGAAGGA
GGAAGAGGAGGCGTTGGTGAAACCGTGATGGTAACGAACTCGAAGCTTCTCGTTTGAATGGACTTATCTGCGACTCGTGGCACGTGGTAGCCAACACCTT
CGTTTACAACAGAACTCGTCTCGGGCGAACAATGGGTCACTTGGTCCTCTTTTATCACCGTATCTTCATCTGCGATTTCTGGTGACAGACTGGGTGGCCG
AGTACTCGAAGAATCAACACCTTGTTCCTGTTCTGCTGCAGGAGGTGGCGCCGACCGCTGGCGCTGCGTCCATATCTCTTGAACCAAACACGCGACTTGC
TCTTCCGTCAGCACCTTCCACCAGTCGACTGTGGGGTCTTCTTCAGCGCCTCTGGTGTCAACCGTATCGCACCCACTTGACTCCTGAACGCCTAGTGACT
CAAAGAATGCAGCCGCGCGTCGCACCCCGCTTACGTCTTCAAGTTCGTCCACTGCTCCACCCGCATACCGAGTGCTGAGTACCTTCTCCGCGTATTTCCG
CACGAGATCGCGCGTCACGTCGCCCACGATCGCGTCCTCGGGGTCGCACTTACCCAGTCTCTCAAGACTCTTCCGCACAATCTGCTGTAAATTGGCGCCA
CTATATGGAGCCTCCGCGGTCGTGGCAGCGAGGGCTCGCGCCATCAAAATGTCGGGCAGCTGCCGCAGCACGCGACCAGCAACATCATCACCGTCGCCCT
CATCCGTTTGCTGCTCTACGAGTCGTCGAGGCTGGTCGTCTGCGTATTGGTCATCTGCCGATGGATGATCATGACGTGGCAGGCGCGACAATATCTCGCC
CGCTCGTGATGGAACCAGTGAGGGGGGAGAACCCTCTGCTCGTCGCGGGAGTTGTGACAGCGGAAGCGGAAGGCTCTCCGTCCGGACAGACTGCTCACAA
TCCTGCTGCGACTTGTACCGTGTCTGTTCTTGTTGTTCTCCTTCTTGCTGCTGTTGCCGTTGTTGTTGTTGCTGGTCAAACGCCGTCGTCACGAACGCCA
CAAACTGCTTGTAATTGATCACTTCTTTCAGCGGCTCGTGGGTCCTCGGTCGTCCACTGCCTCGTGGACCTCGTCGCGTGAGCTCATTGCCTTCCTGCAT
CAAGTGGATCCGCTTGAAGAACGCCACAATGCGAGGCGCTGACACGTGAATCCGCAATCGGTGCAGTGCCAGCGACGTCTCGAGGCGGTTCAAGTGGCCG
TCGTGGTCGGCATCCAGATCGCTGAAGAGCCGTCGCAGGACGTCGCTGTTCAGGCTCGAGCCGACGAGCGCGGGGGCGCCAAACGACACGGCCGTGGCCA
TGGTGCGGTGCTCAGAAGATACTTGACGACCGAGAGAGGACGGCGTATGGGTCTTGTGACCTACGTGGCTATCGCCTTGTAGCCGTCGGTCAGCGACGTC
GTAGCTTTCCATATCCTCCTGTTCCGCGAGAGAAATCTCTTGCTTGGTATGGGCAGTGGCAGAAAGAGGAGGCGGTGTCACCAGCGTCGTGTCCTCGAGC
GATTCGCGGCCTTTCATCAAGGCGACTCGCTCGTTGGATGGAACCACAATCTCACTGGGTGTTGGCACAATCGGAGACGGTTTCACCGCCTCCATTATCA
ACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTTTCCTTCTTCACTGTCTTCTGCCGCCATGGGAATCGCGGGTTCTTCCACGG
ACTTCTCCGCTGTGACTTCCCACCCAAACTCGAGATCCACGGCTCCTTTCAGTGGTGGTATCTTCTTGTTCGTGCTCGTGCCCAACACACTCGATGGCTC
TCGAGACGTCAACGCCGTGCGCTTTGCCTCGCTCCGTTGCCTTGTTTTCTTCTCCTTCTCCGCACGTAATCGCTCGTCTCTCTCCTCCTGGCGGCGCTGT
GTCGCGAGCGCCAAAGCCTCTTGGTGCCGTCGCTGCTGCTCCTCTTCCAGTCGCTTCTTCTCTCGCACATGCCACGACCGCTGCGCCGCACTTGGCTGGC
GCGTGATTTCTCGCTGCACGCGCGCAATGCGCTTGGCCACTTCCCACTGCACGCGCCGTTGGCGGCGGCGATCCGACTCGAAGAACAGCTCGTCCAAAAC
TTCATCGTCGTCGAATCCAGCGCCCCCATTCCCAATGTGTGGCTTGTCCGCAGCCCCTCTTCTTCTTATAATGGAGTTCCGCACGGCGGGGGCCTTGTCG
CGTTGCAGAACGAGCGCGTTGTCGAGCCACACAAGCGGCTGGCTGGTGCGAAGCAGGGCCTCGAGCTCGGCGCTTTTGGCGTTCGCCTCGCTCAGCACGG
CGTACTCCGCCTCCAGCGAGCTCTCCGTCTGTAGCAGACGCTTTGGCACTGTTGCTGGCATGACGTGTCGATCTTTACTATGAACGGTCTTGGAGCTAGC
GTCCAGCGAAGTTGACCTTCTTCCCACTAGCGCCGCTGTCATCTAGCGCTCATACTGCGACTGTTCATCTGAGGTGCGCACTTACTGCTAAGTACGGTCG
GTCCAAAGTGGCTCCACATACCTCGTTTGTATGACATCGGTGTTTTAGTGACACTTAGTGATCCCTTTCTGTCAGTCTTCGGATTTGGATGGGTTCATGC
GGACGGGGCAACCGTTAAAAACCATCTTCAAGCTGCGATTTGCAGGGCCCAAAGATCGCACTGCGATCTTCGCAGCTGCACGGGCCCAGCTGCATTGAGG
AGACATGGCGC