Description :
From Genome Similarity Track
Location :
scaffold_427:1290- 3746
Transcript NameFunction/comments
g8272.t1 hypothetical protein PHYSODRAFT_489104

Sequence
2456 bases(100 bases per row)
TTTTGGTGAACTTTAATATTGCCTGCAACGCAGCAACTACTACTGGTTGCCGGAGTTGGGATACGATGTTTTTTTAAATTCCACGATCCTTAAAATTCGG
GATGCGGAACTCGTAAGTCATTTCTGCTATCTGCGTAAGCCCACCGTTGAAAAACCCAGTAAATAGTAGTGCATGTTAAACGCATCGGGACTCGATTTGC
GTCGTCGCAGGCGGGGAGGGCGATGTATAACGCGGATTCGGCTAACGAAGGCGGGAACGACGGAAACCGAGGTGGTCATCATCTAAACAATCATCACTAT
GACAAGAAGCATTGCGAGAGCGAGTTTGTTGTGCACAATTTGTGTTTTTGTTAAGAGCCTACCAGGTTTCTCAGGTTGGATCGTTACAAACAGAGTGATG
GTCAAGAGTGATGTGCTTCAAGTTGAAGTTAAAACAAAAAGGTGCTGAATAAGCTTTGGGTGTGTCGTTGGCAACGATATTTTTCTAGCAGTGAGACTAC
CGACGAACAGCTTGCAACTCTCGCCAAGACACATTGTCGACCCCAGTTATGGTATTATCGGCTCGCACAACTCCATACTTGTCCGTGACAACAGATTATT
CTAAAAAACATTGTACGGACTAAAAAGGAACTGCGATGTGCGACTGCATGTACATCATTGAAGTGTGCTCCCAGCCTGGAAGTCCAAGGAACCATCGCGT
TTAGAAAAAAAAGTAAAGTGAATGCGGATATCAGGAGCTCTTGAAGCCAGCGCCGCCGGATTTCGCTTTATAGCGCAAGGAAGTCTTCTAGTTTGGAGCA
AGCGTACTGGATAGCGCTAAGAAGCCGAAGTCGCCATGGGCATTTGGCCACTCCATCGCCGCCAGCCGCAGTAACGCGGCTTTCCTCTTCGATTATGGAC
GTGAAGGCCATGTCTTTGCTGGTCGTGGCTTCGTGGCGAGCAAAGTCTTCAGAGTGAGACCTGTTGCTCGAAAAAGAGCTTGATAAAGTTCTCTCGAATG
ATCCGAAGCTTACATGCGTCAGCGTTGCGGATTTGCGGGGTGCAACAGAGCTGCCTTTGGGTCTCCGCAGCGAGGTCCCCGGTGGAAGCGACCGTCGCTG
GACGAACGTACACGAAGTCGGTGCTGACCACGCTGCTCAGTGATAGTGCACCCACCACCACGTGCATCGGTCCCACGCGAATAAGAAGCTGGCCCAACTC
TCATCAAAACCGCCCAACTCTCCGGCGTTGAAGTGGCTGGCGAGCGAGTCACGCTCGCACGCCACGTGCGATGCGATCGCTGCCGCAAAAGAGGAGCAGC
GTCTGACAGGCGCGAAGAACAGGGACAGAGCGTGTGGGCAGCAGCGAAAAAACTTCTCCATGCCAGGGTGCAAGACGGGCATGTCCGCTTTGGATCGCAA
CGCCCACCGAAGCGCCACGCCGTGCTTTAAGTCGCTTCAAGTGAGGCCTCCACAGCCCCGATTCAGCCATGGTGCTGGACGATATCGCGCAGCTCGTCAT
CGGAGACCCGCGGCAGTGGAGACTTTGTTTGGGGCGAGCGAGAGCGGGCCTCCGTCGGCGTGGCCGTCCAGCGTGCCTCCGAACCTGTGCCACTATTGGA
CTCGACGTGCGCATAGCGGGGCGCGGAATCTTATTCTCGTACCGTAATGCCGCGACTTAACCTTCGATCGCCGTACTCATGTTCAGCAGGCTCGCCGACG
GCTCTTCTTCCAAATGGTAGCAATTCCTCCTTCCTGGCAGGTGCACGGGCCAGTCCGGGTGATCATGTACCTCGAGAGGAGAGAGTTCATTCTCGGATTC
GCTCGCTACAGCAACAAACGCCGCCCCCCTCACACACTTCAACCTGCCCGTCTCGAGGCCGGTCCCGCCCCAGTAACCATTACGACCGCCATTGCCCCCA
CCGCCTACTCCATGCCAAGCATGCCGCCGCTCTCCATATCGCTCGACTTCTTCGACATGGACGACATGAATATGGAGCAGCGAACGCCACTGTCCTCGGC
CTCCTCGTCCTCCTCGGAGGTCAGCAAGACCAGCCCCACCCGGAAGATCAAGAAGCGCAACAGCACTAAGGTGCTCTCGTCGAAGCGACTCTCAAACGAG
GAGAAGCAGGCCAAGAACCGCCTATTCGTTAAGCGCTGCTACTACAAGAAGCGCGAGGCGCTCAAGAACCTGCGCGAGGAGGTGGCCCAGCTCGAGAGCG
AGTTCGAAACCGTACTGCAGCGCTGGCAGCAGCACAACGAGCACTCCGCCGAGGCCTTCCGTGATGGCAGGCGCCGTATCTCGCCGCACGATCTGTACGC
CGAGCTCACGATTGTGCGCAGCTCACTGGTTGAGGAGCAGCAGCGGCTCAACTTGAGACTTGCGGACCGCCACCTCTTCCGCCAGCGGCTACAGCAGCTC
TACGAGCCCACGCGCTGAGTGCCGCTCTACCAGTCCGCACAAACCCCGCCCTGATT