Description :
From Genome Similarity Track
Location :
Scaffold_285:1290- 3383
Sequence
2093 bases(100 bases per row)
AAAATTCCTGAAGGGGTCTTGTACTGTGGTCTTTCCATCAGCGGCCCCTCATCCTCCTATGTCGGGTCCACCTGATGGTCAACTCGGGCGGTAATTGGCT
TCATGTGCCAGATTAGCGACTCATCATATCTTTGAGAGACCACCGAGACGAATCCTTGCGCTCTTGGCACTTGGTCCTTCGTCAACCTCATACCTATCTT
GGTATCTTCATGCAATATCAAGGTGTGGAAGCTGACGTTGGTCACCTCTAGAAAAATTGTCAGCGTCCTACCTCTTGGAACATTTTTGTGACCCACCATG
CTCCTCTCGCGACAGAAAGTTTTTCGCTATTCCATGGTAAACCTTTTTAGAGGTATTTTCACATACCTTCCAACAGTTACCTGCGCATACTGACCCATCT
ACACGTCTGACACTAGGCTATCAAAATCGTCCTCCGTCCGGATAATCGCACTTAATATTCATTAAAGAAACAGTGTTTTTATCCGCCAGGTCTGACTGGA
TACCGACTCGAACCATGACGTTCATACCCAACATGACGTCTTAGCCTCAAATAGGGCCTACCCGCACATAAAAATGTACTCCAAATTTCCATTCAGATTG
ATCTTGATGCGAGTGCGATCTTCCGTAGTATATACGGATTCTCCAATGCTAATACACTCTTGTCATTCACTTTCGTCAATTTGGCAGCCTAGCTTAGAAG
CAAAGGCGGTAATAGGATGGATATCTCCGCACCACTATAGAACAACAAGTTCGCGAGATTATTTTGCTGACCTATCTAGAGGCTTTAGCTTGACTAAACC
ACTTCGTGGGAGTATTGTATTCAACACCCCTGAATTCTACCGACGATAAGTCAAACTCCATCTCTGCGTTTCCTCGAGCAAAGTCATTAGACCCATCAAA
AGAAGCAATATGGGCCATAGTGCATTTTTCAATTTCCGATATATTTTCAATCTTCTTAGATGATGTGCTAATCTCGTTCGTGGGCTGCTTTTCCACAGGG
GCAAAGATACAGAAATGAGAAAGCTCGGCTCATACCATATTCAAACCTGGCGAACGTCCTAATTTATCATCTTCTCGGTCTTTCCGGCAACATTTCGGCA
TTCTTGGTTGGGTTGTACGATTGACGAATCAAGCTGTACAACTTTATCCGGCACTTCCCAACTTCATGAGTCCCCCACGCCCTCGGCACACAAATAAGCA
GCGATCCGATGGGTGAGCCTTCTTCCGACAGAGTTCACAGGCCATTTGATACCAACATCCCAAGTCTCCAGGTTTTCTGAACCAACAATGGAGCGGCCGA
CGAAGTGCGGGATTACGGTCCCCCTCCTTCGTGTCAAAGCTGGTTGGCCCCCCTATTAGTTCGGCTCCTCGGAATCCTCATACCTGGGTCCTTCTCCGCT
TCCCGTTCCATTCGACATACTTGCATTAAAGATTCTTCGTTTTCCGAGTTGTCCAGGCTGGAGTCCTCAAAGCTCTATTTTTCCAGGGTTGTCCGAACTG
TATGCACAGAGCGGCGGTTTATCTCTCTTGGTCGGTCGAAGGATGGTGGTTCCTTCTGACGAAACGTGATCGATCCAAATTACGTCTTACTTTGTCTTGT
ATTCGTTAGTTGACGCACTCTCAGCACTTCTCCAATTCTTCTACAACAATCAGGCATAGTCAATTGGTCTGCTAGCTCTGGATCGTCCAAATTCTCATAT
AGTGCTCGACATGTCATGTCTTTTTGAATCTTGGGCGGTCCGTTTTTAATTTTCAACTTTGCCCTGAGTCCAATCACATTCCAACGGTATAGATAGTCCA
ACGGGTATTCATCTGACCTCTTCTCAAATGGTATTACTGGGGGGAAACTGGTTCGACCAAACCGCAGAACGGCATCCGGAATTGTTTTAATAGTTCGTAT
CGCTAGTTGGCGGTACCAGTTCTGCGCTGGTTCGGTCAACATTTCTCCAGAAACAAGACACTTTTATCCGTCTGGCTCTTGATCTCTCGTGTATACAGTA
CTTACGGTAGTCACCCATATGCGTGCTCGGTTCTCGCCTTGATCCCTTCCATGAAACTCCTTGAGACCTGAGATCGCTGAGAGCTTGTGCGGG