Description :
From Genome Similarity Track
Location :
Scaffold_664:1290- 2827
Sequence
1537 bases(100 bases per row)
GCGCCTTCTTGGTTTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAGGACCACCTCGGCTAGCTCGCCTGC
CTTTAAGGCTTCGCCAAATTCGGCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTGTCAAGGCTGATATCGCCTTCTACCTCC
CCCGTCACTCCGTTCACGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGTTGGACACCTCGTCCGACGTCGAAGACGTCA
CAGACGCCCTGCGTCTTCTTCTCCTCTTCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGACATCTCCGTCACCACCACCGGGTGTAGCAGC
ACCATCACTCCTCGAAGAGGTTACAGTGTCTCGCAAGACACACGGCTGAAAGCCAAGAGGTCCTCGACCTTCACACAGTGAACTAAGTGTCACTTCACCT
GCATCTCCTGGGCCACGCCCATGATGCCTCGACTCGCCGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTCATCAACCAGATTCGTACCACTCAGTG
GATTACGCGCCACTCCGCGCTCGTCCTCACCAGGACTCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGCGAATAACGTGCCGCACCACGTACGCC
CTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGATCGCGCCAAAAGCGCTTCTGC
TTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTTCAGTCGATCCATGGCTCATGGC
GTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATTCAGGTCTAAGACCAAAAAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAG
GTCGACAGAGACCTTCGACACAGTTATCAGTGTCCCCGGCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCTTCAGCATACAGCTGA
CTCCCTTCTAGGGTGGAGCAACGGGCGTAGTTGTCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGACGAC
CAGCAGCCCGGCTTGCACACACGCTTCTCGTAAGAGAACTCAGCTCTCTTCGGGGCTGAGCCCGTTGCCCTCTACCTCCTCGAGGCACAACAGAACTCAG
TTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAATTGCCGTTTCCCGGCGATGACCCGGAGGGTTTGCTCGCCGGAGCCCCGCGCTTCTTGCGCAGAG
GGCAATATGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGACACGCTGCTTCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGC
ATAGCTGAGGTCCATCGGTTCTGGACCGCTCGAAGAG