Description :
From Genome Similarity Track
Location :
Scaffold_1493:129- 4477
Sequence
4348 bases(100 bases per row)
GTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGGCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGC
CATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAGAACGGGG
TATCACCTCGGATCCTATCTTGGGCGGTGTTCATCACGAAAGGGGGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTT
GAGTGCTCTCGTGATTGTCTGCATCATGCGCTCGGCCGACCCATTAGCTTGGGAACGGTATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTG
AAAGCTCGAAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGG
CAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCAGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTT
GGGCAACGAGGGGATATGATCCATGGCTATGATGTGGAAAGGGTAAGTCGCTTGGATATCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGCCTGT
CTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGACAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCC
TGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACAAATCTCATCAATCCATCCCGATCCTCGTTGA
CTCTCTTCGTAGGGGGGAATAGAAGAGCAAGTCTTTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCT
CGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTT
CCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACGTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTC
TAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTG
GCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGC
AGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAG
TAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAGCCTCCCATCCAGGTAGTCTCCACAGTATTGCACTG
TACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGTTCGGGATCTGGATCCGGC
GTTTGGGCTCTTTCTTAGGAGCGACCTTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCC
TTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGC
GTAGAGTGTCGAGTCAGGCTCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTC
CGTCGTTCACTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTC
GCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGA
GCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCTCGGAGTGGATCCAGCTCCT
GTGTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTCGGATTTTGATCCGGACAGCTGAAGT
GGTCATCGCAGCAAAACCTACCTCTCTCAGTTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGACCAAG
CAGGATTGCATCGCCCGTAGCGACCGTGGGAAGGACAAGTCTGCCAACGAAGACAGTTCCTTAGGATTCGCCTCCAACCCCTCCTTGGAGACTCGATGAC
CTAGGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGAAGGGATGTCACTCTCTCGCA
CAACTGATCCACGATTCTGCCGGGATTAGAATGTCGTCAATATAAGATCTGCGTCCTAACACAGACGGGGTGCCAGGATCCCCTGGCTCTCCCGCTTCGA
ATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCGTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCATTATCGATCAGGCGTTGGTAGAT
CTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTC
ACCACCCAGAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGGGGCATCGGATACACCATCA
ATCGATTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATAATTACCACCGGAGATGCCCACGGGGACGT
TGAGAAATTGATGATCTTGGCTTGCAGCAGGTCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGGCACCTTTGAGCGATCGGTTTCGCGTCGC
CGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAAGGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATGTTCTGACGTAACCG
ATCCACTTCCGTGGGTTCGTTCGCCCCTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGGACCTCCGGGATCACCGCCAGGCCTTCTCCGAGAT
TTTCGGCGTGTAGATCCCCGCATTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACCCTGTTTCACC
TGACAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGATATCAGGGAAGCTCTAGCTAGTTTAAACCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCT
CGATAAGGATCCAGGCACTTTGCCCCATGCAAAACTAGGATCCATTCTGGGGTCAGCGGGATCTGGCGACCCGGCTTCAGCTCTCTGCGATCCTTCATCC
ACCGACCCTGCGTTATCGAGGGGCCGACTCTGGGAATCATCCCCGGTCTTGAATCCAACCTCCATCGCTTGGACCTCCATCCGACGATCCCTCTGCAGGA
TCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGACCTCGGTAATCGCCTC
GTACGCCAGATTCTGCCATTCTCTGTAACGACGTGGTCCAGCTGACACATGTCCAGGTCGCCTAGGGATACCGGCCTTCGCCAACCATCGTCCGATCTCT
TCATAATGGTCCAGTAATAGTCTCTTGTCTCTGACGTTCGTGACCTGGAGGTATTGCGAACGACCTGGTCCCTGGATTACGGTAGGCACCCATTTCTCGC
CCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGACCTGGCAGTTTCCAGGTTTCTCCGGGCTCAATCCAGGTCGTCTTATCCGCCCTTAT
GATCCTCATCTTCGCCCCATGCAACGGCCGCCGTCCGCGGAGCTGGAT