Description :
From Genome Similarity Track
Location :
Scaffold_2797:129- 3094
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2797-fgenesh-gene-0.0Microtubule-associated protein

Sequence
2965 bases(100 bases per row)
GGCCACTTCGCCTTTGAGCTCCACGGACTGTCCGTGCACCCGCTTAAGAAGGAGTTCTGCACCACAGGCGACGACCGAACGGTGCGCATCTGGGACATGA
GCACCCACAGACAGGTGCGTATGGCGATGCTCGAGGCGCCATCGCAGACGTGCGCGTACTCGCCCGACGGCTCGCTGCTTGCGGTCGGCCAGGGCGCCGA
CGACTCAAGCACGAGCCACGTCTCAAAGAAGCAGCAGCTCAAGCGCCTGAACGTGAACAAGCAAGGCGCGTTCGCTGTGCTTAGCGAAAACGTGCTGGCG
GTGAAATACGAGACCAAGGACTCGAAGAAGTTCATCCGCACGGTCCGATTCTCGGGCGATGGGCTCACGCTCGCCGTGGGATCGAGCGACAACTTCATCT
ACGCGTACAACACGGAGGACTGGGCGTCCAAGGGCAAGTGCAAGGCGCGTGATGCCGCGGCCGTGCTTAGCCACTTTGACTTCTCCGCCACGGGCGAGTA
CATCATGGCGAGCGCGTACAACAAGGGCGAGATGGTCTTCTTCGAGAGCGCCTCGGGCGTCGAGATCACGCGCATCGCGACACTCAAGGACGTCGAATGG
CTCTCGTGGACCTGTCTCTACGGTTGGTGGGTTCAGGGTGTCTGGCCCACTCTAGAGCGTTGCGCCTACGAGGTCTCGGCCATCGATCGGTCCAACGCCC
AGGAGGCTCGCCAGGGAGTCACACAGCTGCTTGTCGCAGGCGACAACTTTGGGACGCTGCGGCTCTATCGGTACCCGTGTGTGGACGCCGCCAGCGCACT
TTATCAGGTCTTCCAGGCCGCGAGCAGCGCCATCTCGGCCGTGCGCTTCAGCGCCGACAACAGCATGGTCGTCGCATGCGCCACGGAGGAGCGCTGTGTG
TTTCAGTGGCGCGTCGAATACGAAGAAGAAGACGCCAATGCGGGCGACAGCAATGCGACCGAGTACGAGTATCACCCGACGTCTGACGACGAGATGGAGA
TGAGTCACGGCGAAGAGCGGACTCCGTTCCAAGAGGCCGCAGCAGTGGGCGATTTTGCGCTAGAACTGCTGTATCAGCGTGGCGAGTCAAAGGACGACAG
TGGTGGCATTTCCGCTGCCAGTGCTCCCATTAAGCCGTGGGTGTCCAGCAGCATCGCACCCGCGGACGCACCTGACGAGACGGACCTCGAGCTCTCAGCC
GTGCCGAACGAGAACCTCGAGCTCGAGTGGGTCTACGGCTACCGGTGCCACGACGCGCGCAACAATCTGTTCTTGACCAAGAACAAGTGTCTGTTGGTCT
TTCCTGCTGCGAACGTCGTGATCATCCAGGACAATAAGCTCTGGCTTCAGAGGCACTTCAAGCAGCATTCGGATGAAGTCACGAGCCTCGCAGTGCACTT
TGGCGTCAGGGGCAAGAAGCGGCTGGCCTCGTCTGCCGCGACCAGTCATTCCACCAGTAGAAGTACTGACGAGAACTCTTCGTCCACTGTGAGTACGAGC
AACACACTGGAGATCGTGGCCTCGGGCCAGATGGGCAAGTATCCGGCGATCCATGTCTGGTGCATCGACACGCTCGAAGTGCTCGTGTCGTTACGAGGGT
TCCACCGACGCGGGATCGCTGAATTGCGTTTCAACGCAGCGGGCAACCTGCTGGCGAGCGTCGGGCTCGACGACCAAAACGCGCTCGCGATCTACGACTG
GCAGAGCGGTGTGTTGCTCGCACGGGCTAGTACAAGCGGCGTGGGCCGCATCCTCGGAGTCTGTTTCCAGCAAGAGACCCCTCATCAGCAGACGACGACC
GCAGACGCGAGCTCAGAGCCACCGGCGGACCCCAGCAGCGCTGTGCTGGTGACCGTTGGCGTCAAGGTGCTGTCGTTCTGGAGGCTCTCGGGTCAGAACC
TAGTCAAGAAGAGCGCGATCCTGGGCAAGAAAGGGCTACAGCAGACCTTTTTGAGCGTCGTGTTCTGTGGGAAAGACGCGGTCGTGGGCACCACGAGCGG
CGATCTCTACCGCTTCAAAGGCATTGAGCTCGTGAGTATCGTACCTGCCCACGCTCGCAGCGTTGCAGCACTGTACTGCATTCCAAAGACGCCGCACCAC
ATCGCCAGCGGCGGCAAGGACGGTGTCGTGAAGCTCTGGAGCTCGGATCTCGAGTGTCTGGGCGAGTTTAGCGAGTTCAACGGCTCGAAACACGCGATCC
GCAGCGTCTACTGGGACTTTGAGCGCAACATCCTAGTGATCGGCACGCTGGGAAGCAGCATCCACCAGATCTCGTCCCTGGACGGCTCGGTCATCACACC
CCGCACGCCTGACGGCACAGACGTGACCAGTATCGAGAACCACTTTCGAAAGGAGCTGCATGGGCTCAGCGTGTGTCCGTCGAAAGAACGCTTCTGTACC
ACCGGTGACGATGGCGTGTTGCGTGTCTGGGACTTGCTGCGCCACACACAGGTACTGGCCAAGGCGCTGGACACGAGCAGCCGCGCGTGCGCGTACTCGT
ACAACGGAGACTTTGTCGCCGTGGGGCTCGGCAGCGGGGGCACGGGCAAGCGGCACAAGAAAGACGGCAGCCTGCTGGTCTTTGAAGAGCGCACGCTGAG
CGTCGAGCTCGTGTACGAGACGCGCGACACGAAACAGTCGATCTCCGTGATCAAGTACTCGCCCGACGGCCAGTCGCTCGTGGTCGGCTCGCTCGATAAC
GCCGTGTACATCTACGACGTGCCGAGCAACTACACCAAGCGCGCCGTGTTTAGCAAGCACAAGAGCTTCATCACGCACGTCGACATCTCGAGCGACTCCC
AGTACATCCGCAGCAACTGCGGCGGCTTCGAGCTGCTCTTCGCCGACATCACGACCGGCTCGCACGTCGCGAGCGCCACGGCTTTGCGTAATCAGAAGTG
GGAGACCTGTGCGACGGTGTACAACTGGTTTAACCAGGGCGTCTGGCCGGCCACGGCGTCATCGA