Description :
From Genome Similarity Track
Location :
Scaffold_3992:129- 1293
Sequence
1164 bases(100 bases per row)
GCAAAAATCTACCTCTCTTAAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTG
CATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAGTGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAC
TCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCACACAACTGAT
CCCACGATTCCGCCGGGATTAGGATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATTCCCTGGCTCCCCTGCTTCGAATGGATC
CACTTCTGCATTTCCTCCCCCGGATTCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGT
GCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAATCACCC
AGAAACCACTGGCCATGTCTGGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGTTCATTGATTAGAGGCATCGGGTACACCATCAATCGAGT
CAGGCTGTTAACCAGCCGGTAGTCAATGCACAGACGTATATCCACACCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAA
CTGATGATCTTGGCTTGCAGCAGGCCTCTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGT
CGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTGATGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAG
ACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATG
CCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCG