Description :
From Genome Similarity Track
Location :
contig_3:1289742- 1291973
Transcript NameFunction/comments
g1042.t1putative RNA helicase

Sequence
2231 bases(100 bases per row)
CCAGCTAGCCGCCACTACGAAGTGAATACGTCACGCACGGAACGTTTACCAGCGACGACCGCCGCCACCACCGTATCCACCACGGCCACGGCCTCCACCA
CCACCGCCGCGACCCACAAGGTCACGCAGTTCACGCGGCACCTCCTGTTCAGCCTCCTCCATGATCTTCACCAAAGGTCCAGCCAGTCGACCATTGTTAC
CGGGCGTGAAGAACGAGATCGACGTACCCTTGTTACCGGCACGAGCCGTACGACCGATACGGTGAATATAGTCCTCAATGTTCTTGGGCATATCGAAGTT
GACCACGAAGCGGATGTCCTTGATATCCAGACCACGAGACGCCACATCGGTAGCGACCAGGATCTGAGTCTTGCCGTCCTTGAACTCACGCAGCACGTAG
TCACGCTCCTCCTGCGATTTGTTACCGTGAATGGCCTTGCACATGTAGCGAGTGTCACGCAAGTTGCGGCTCAGCTCATCGGCTCCACGCTTCGTCTCAC
AGAAAATAATGATACGTCCTCCCTCGTAAATGTCGCGCAGGTGGTCCTGTAGCGCAGTGTACTTCTGGTGGTCGTCCATAACCTCAACGATCTGCTTGAT
TTTCTTGTTAGCGGTCAGTTCAAGAGAGCCCACCGTCACTTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTAGCC
GACCACATCAACGTCTGACGGTCGGGGCGGATCTGGCTCACGATCTTGCGCAGCTGCGGCTCAAATCCCATATCGAGCATGCGATCAGCCTCGTCAAGAA
CCAAGTAGGTTACACGGCGCAAGTTCGTCTTGCCCATGCTCAGCATATCAATCATACGACCAGGCGTGCAAATGCAGATCTCCACGCCGCGACGCAGGTC
CGCGATTTGGCCACCCTTGGGGACACCACCGTACACACACGTATTCTTGATCTTGGAGCTAGCGCCAAACTTGTTACATTCCGCCTGAATTTGCACAGCG
AGCTCGCGGGTCGGAGCGATGATCAGAACAATCGGACCGTCGCCAGGTTGCAGGTACGGCTACAGCATAAAATAAAAGCACAAAAAGTTAGGAACCACTT
AGATGCAATCGAGCATATGAAGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTGAGGTGTTCGCGTGCTGCTCTTTCTTCTGGCCACCGCCG
ACAACGCACCAATGCATGTTTCGCACCGATTGATCGCCGAGAAGACGCCGGTGGTCGTCGAGAAAGCAGCCAAGATTTGCTATCTGTATGCGTGTCGATC
GTGCCGAGCCAAACAGCCGAAGCCGTCGTAGAAACTCTCTCCGTCAAATGTTCGACCGGCACTCCAACACAGCAAATCACGCTTCGAATCAACTGAAGTG
ACGAAAAACACGCGAATGCCGCTTACTCTAGGATCGCACAATAGCTCTCCACTAAACGAGCATCCGTGTGGATCGACCACGCTCTGAAGACCGTATCCAA
ACCCCAACGCCTCACGCGTGTGACTCGCTCATCGCATCATATGCGCGAACGATCGTCGTGTGCTTGACACAACGTTGCTAACTCCTCCATCAGCGCACCA
GCGCCACGGAAGATGCGTCCAACAACGACCAAAAGCCTCTACAAAGAGTCTGCTTCAAACTACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAA
GAAAGCCAGCGTTTTGCCGGATCCTGTCGCCGAAATGCCCACCATATCGCGTCCTGAAAGCGCCATCGGCCAGCCCTGGCACTGAATGGCCGTGGGCTTG
TCAAAGCCCAGACGCACCACCTCCTCCAGCACGTACTCGGGGAACGAAGCCTCTTCGAACGACAGTACGCACTTGGGCACGCCCTTGCCAGACACGATAA
TCTGGTTCTCACGCTTCCACTGATCGTACTGATCCTCAGAGCGCTTGGTTACGTCCGGATGCTCGTAGTAAAAGTTTTTCTCGAACACCGGCAGCTTCGA
CATGTCCCACTGGATGTGCGTGTCCAGATTGGAGCCGAGGTCACCGCCGCCTCCACCGAAACCGCCACCTCCCCCACGGCCGCCGCCGCCACCGTATCCA
CCGCCGCCACCGCCTCCGTAGCCACCGCCACCTCCATAGCCTCCGCCGCCACCTCCACCACGAGAGTAGCCGCCGCCGCCACCACCGCCGCCGTAGCCAC
CACTGCTGCCTCCGCCGTAGTCACGACGCGA