Description :
From Genome Similarity Track
Location :
Scaffold_2647:1289- 2771
Transcript NameFunction/comments
Phyta_totarag14705hypothetical protein PHYSODRAFT_347717

Sequence
1482 bases(100 bases per row)
CAAAAAGTTCCTCACCGCGGAGGACCTCAAGATAGCGCTCAACATCTTCTGTTGCGTCTACGGCATCGGTACGCTTGGTATGCCCGGCAACTTCTCGCGC
GCTGGACCCGTGCTGGCCGTCATCGCCATGGCGTTCATGGCATTTGCCAACGTGTATGCGTCCGTGGCCATCTGCcgtgtgatgctgctggcgcccAAGA
GCGTCAAGACCTACAGCGACCTGGGTGAGTGGTGCATGGGCAAGTGGGGCCGATGGCTCTCGGTCATCGCGCAGATGGCCTCGTGCTTGCTCGTGCCGTG
TGTGTTCCTCGTGCTGGGCGGTACCCTGCTGGACGGCCTCTTCCCGgacgccttcagctcctcctaCTGGATCTGCTTCATGGCGCTCATGTGCCTGCCC
GTTTGCCTCATCCCAACGCTTAaggaaggagctggcgcggCCTTTGCCGGTTGCGCAGGCACGCTCGTCGCCGACGTGATTGGCGTGGCCGTCGTCATGC
ACGGCATGCGCGGCCATCCGTCCGTGCCGTCGCCCGAGATTAAGTTCTCGCAGGTCGCGGGCATGTTCGGCAACCTGTCGCTCGCGTACAACGCCGGCAT
TGTGATCCCGgccctgcagcgccagcacagcGATCCCACGCGCATGCCACGCGTGGTGTTCGTCacgatggccttcatctcGTGCCTGTTCCTGGTTCTG
GCCAGCACGGCGTATTCGTCCGTGGGCTGCCAGATCACGGGCAACCTGCTGTATTCCATCTACCCGGACCCGACGAGCGGTCTGACCACGCTGGGTTTCA
AGTCGGACTGGGGCGCCGTCGTCATGGCCTACTTCTTCATGCAGCTGCACATCACGATCGCCTTCTCGGTAATTTTGAACCCGgccttcttcctcgccgA
GCGCATGGTCCTCAAGATGCACCGGAAGACGGAGGACGATATGGAGAACGCCCTCCCCTATGCTGCCACCTCGTACGCCGCCGCGGACACACCCGGCAAG
GATGCCGTCAACGGCGACGACCGGCGCTCGTCCAAGATGTCGTACATCTCGAACGCCGACGCCGAGAACCCGTACTttggcgacgtcgaggcGGAGGCTG
CCGAGTACCGTGGATCGAACGCGATCAAGTACGTCATCCTCCGTATCGCCATCATGGTGGCGCTGGTCATCCTGTCGATTATCCTGAAGGACCACTTCAC
CGACCTGGTGGACTTCGTGGGTGCGTCGTGCGTCACGCTGATCAGTATTCTGCTGCCCATTATCTTcttgctcaagaagctgtGGCGCGAGATCCCGCTG
TACGAGAAGATCCCGGCACTgatcgtggtggtcgtgtgTGGCTTCCTGGGCTGCTACGTGACGTACACGTCTGGCAAGACGCTGTTCGCGCCGACGGACT
CGGACGTGGAGTTCCCGTACTGCGACAGCGAGTACGAGAACCAGGTGTTCTACAACTACACCGCCGTGCACGGTACGTAAGC