Description :
From Genome Similarity Track
Location :
Scaffold_7:128875- 131407
Sequence
2532 bases(100 bases per row)
TACTTAGCCTTAACTCAGGCACTTAACTCTTACGACCAGAGACGTCTTTGAAAGACGTGTCTGAAACTGATCAAAAGGGGAACTGAATATATTTACTGAT
TTATAGCGATAACAAACCTTACTAACGTCTTTAACCTTAAAACTATGCTACCTAATCGAATGGTCCTCATGCTAGTTCTTCTTGTGTACCACACCAGAAC
TACGTCGCCTCTAAGAAGACTCTATTACAATAGATATCCTCTAACCATAACCGATAGGGCACGGTGTTATCGCTTAGCGTATGTGATACAAAAGTACGTC
TTATCAGCGATACTGATCTCTTTCTGTGTATACCACACCAATGTACCTGGTTATCACAACTGTTTGTGCAACCCCGTTACACAAAGCTTGACAGAATTTT
GCGCTAAAGAACACATAAGAACGATTGCAAACCATACTGAACTAGGTCAAATTGATGTTTAAAAAACGGTTATAGTGATATTATACCCTCAAGGCATGCC
TTTAAAAAATTAGCCAATCATGTAGCGTTATATCAAACTGAGGGAACTTTACCAGAAAACTGAGGGCAGATTAACGATTTCCTATTTTCGTCGTGCAGCA
GTCGCGACTCCTCCACGACTTGTTGCACCAAATCTTTCTTGAACAAGTATACTACTCTATCCCATTTTGTTATGGACTATTTCCCGTTTGGCTCGCATGT
TTGACACAGGCTGTATTTTTAGTCGAAAATACCACCAGCGTTAAGAGCTCATTACGAAGCGTTATATGCAATGTTTGGAGCCCATTTAGCTGCAGATACC
GAAGAAATAACCTAGTATTTGTCTGATCTTTTTTCAAAGGATTTAGATTTTTTTGGCGCAGTGAAGTCCGAAGGTGTTGGAATTCACTCGAATAAGAAGC
AGCTTGAAAATCTAATGAACAGTTTGATCGTAAAAACTGCAGAATGGATGCATAAAGAAGTAAGCTTTTACATTATAATCTGGCAGAATGTGTCAAGAGG
TGATTAAATATTGGATGATATTAGCCAATTGAAAAACACTCTTTTTAATCATCACTTGTAATCATGCTCAAGGCCCAGATTAGACACTCTTTCCAAGGAA
GATAACTCTTCAGAAACAATCACAGAAGAGATCGGTAACGACGAAGGAGGTGCTCCATGTGAGAATGATTTTCTTGACTTGCGGCAGCTGAAAATTGTTG
CCACCCTCGTTTTCGCTGACGGGCACTCATTGCCAATACCTCAAAATAGCCTGACTGTGGTAATAATTTGCTGAACAAAACACACTTAAAAGATTTGGGT
TTTAGCCGATCATATAAGTTCAAGTTTGTTCACGTCATATTCCAGTCCATAAACAAATGGAACAGAGTAATACACGTTAGTTATGTGCCAACGAGTGGTC
GTGTGTCATCACCACTTTCTGCCAATTGATCCTGTTGAAAGGCGAGCTTCAGTGTAATGAACCAAGAAAGTGGCACAATTATCATTTTTTGTTATCATGT
TTGCGCCGAACGACTGTCGGGAGTTTCATTTTCTGATTTCTCCTGCCGTAAAGATTTGTAGCGAGATAGATAATAAAAAAGCTAATATCACTCTCTCTTT
TGCACCTAAGTGTGTGTTCTCTAGTTGTCACGTTACGTTCGAATTTCTAAATGTCAAGAGCCCAAAGCATGCGGCAACAAGAGGCGGTGCGCGCGACGGC
GCGCATGCGAAAGCAGTACCTTCCACTGGTCACGAAAAGTCCAGTGAGCACGAATATTATGAAGAGAATAGCAAGCCAGGCGTTGTTCATGCGGTGGACG
ATGCCAACATCAAGAGTGACGACGTATCAAAACTTTTCTGGTGTTGATGAGAGGGATAACCGGACGTCTTGACAGGATCGAGGAGTCACAGACAAGGTTG
ATGGGTGCCAAGGAAACGTGTGAGAGACATATGTACACACCAATGACCCCGCCTAGACATTCAAGCTTGTTTGTTTTGGTCCTGGGAGGGAGCACAAGGA
TGCACATAGAAAATTTTGGAAATGTTTTTAAATGCACCGGTATTTACTTCGAGGAGGCCGGTTGAAGGACATATTTCATTTGGCGCAGGACAACCCAAAT
ATGGTGGTCCAAGGCCTACTGTTCATGCTCAAGTTGCTCCAGGACTTGGGATTCCGGGTACGTTGGTTGAAGGTGGAGGGCATGGATATATGCAACACCA
AGACCCAAATGGGAATGATCAAGGTCGTGAACACCTATTTCAAGTGAGTTAACCAGATACAAGACAAAATAAGCTTGGTATTCGACCATTTATGGACGTG
AGCTGTACGAAGGTCTAGGCTCGGTTTTTTTCGGATGGGGTTGAAGATTCAAGTGATAAATTTCTTTGGCACAGTCGTCTTGTGAATATGAATGGCCGGA
AGACGTGAAAATAAATTTGCTTGTTTTGTATCGCTATGGGAATGCAGACAGGTACTACAACAGAAAAGTTGCTATGTGGTGGAGTCAATTACCCACTTTG
CAGTATATTACGGAAAAAATGATGGAAGCATT