Description :
From Genome Similarity Track
Location :
Scaffold_7:128864- 131403
Sequence
2539 bases(100 bases per row)
ATGCCCAATAGTACTTAGCCTTAACTCAGGCACTTAACTCTTACGACCAGAGACGTCTTTGAAAGACGTGTCTGAAACTGATCAAAAGGGGAACTGAATA
TATTTACTGATTTATAGCGATAACAAACCTTACTAACGTCTTTAACCTTAAAACTATGCTACCTAATCGAATGGTCCTCATGCTAGTTCTTCTTGTGTAC
CACACCAGAACTACGTCGCCTCTAAGAAGACTCTATTACAATAGATATCCTCTAACCATAACCGATAGGGCACGGTGTTATCGCTTAGCGTATGTGATAC
AAAAGTACGTCTTATCAGCGATACTGATCTCTTTCTGTGTATACCACACCAATGTACCTGGTTATCACAACTGTTTGTGCAACCCCGTTACACAAAGCTT
GACAGAATTTTGCGCTAAAGAACACATAAGAACGATTGCAAACCATACTGAACTAGGTCAAATTGATGTTTAAAAAACGGTTATAGTGATATTATACCCT
CAAGGCATGCCTTTAAAAAATTAGCCAATCATGTAGCGTTATATCAAACTGAGGGAACTTTACCAGAAAACTGAGGGCAGATTAACGATTTCCTATTTTC
GTCGTGCAGCAGTCGCGACTCCTCCACGACTTGTTGCACCAAATCTTTCTTGAACAAGTATACTACTCTATCCCATTTTGTTATGGACTATTTCCCGTTT
GGCTCGCATGTTTGACACAGGCTGTATTTTTAGTCGAAAATACCACCAGCGTTAAGAGCTCATTACGAAGCGTTATATGCAATGTTTGGAGCCCATTTAG
CTGCAGATACCGAAGAAATAACCTAGTATTTGTCTGATCTTTTTTCAAAGGATTTAGATTTTTTTGGCGCAGTGAAGTCCGAAGGTGTTGGAATTCACTC
GAATAAGAAGCAGCTTGAAAATCTAATGAACAGTTTGATCGTAAAAACTGCAGAATGGATGCATAAAGAAGTAAGCTTTTACATTATAATCTGGCAGAAT
GTGTCAAGAGGTGATTAAATATTGGATGATATTAGCCAATTGAAAAACACTCTTTTTAATCATCACTTGTAATCATGCTCAAGGCCCAGATTAGACACTC
TTTCCAAGGAAGATAACTCTTCAGAAACAATCACAGAAGAGATCGGTAACGACGAAGGAGGTGCTCCATGTGAGAATGATTTTCTTGACTTGCGGCAGCT
GAAAATTGTTGCCACCCTCGTTTTCGCTGACGGGCACTCATTGCCAATACCTCAAAATAGCCTGACTGTGGTAATAATTTGCTGAACAAAACACACTTAA
AAGATTTGGGTTTTAGCCGATCATATAAGTTCAAGTTTGTTCACGTCATATTCCAGTCCATAAACAAATGGAACAGAGTAATACACGTTAGTTATGTGCC
AACGAGTGGTCGTGTGTCATCACCACTTTCTGCCAATTGATCCTGTTGAAAGGCGAGCTTCAGTGTAATGAACCAAGAAAGTGGCACAATTATCATTTTT
TGTTATCATGTTTGCGCCGAACGACTGTCGGGAGTTTCATTTTCTGATTTCTCCTGCCGTAAAGATTTGTAGCGAGATAGATAATAAAAAAGCTAATATC
ACTCTCTCTTTTGCACCTAAGTGTGTGTTCTCTAGTTGTCACGTTACGTTCGAATTTCTAAATGTCAAGAGCCCAAAGCATGCGGCAACAAGAGGCGGTG
CGCGCGACGGCGCGCATGCGAAAGCAGTACCTTCCACTGGTCACGAAAAGTCCAGTGAGCACGAATATTATGAAGAGAATAGCAAGCCAGGCGTTGTTCA
TGCGGTGGACGATGCCAACATCAAGAGTGACGACGTATCAAAACTTTTCTGGTGTTGATGAGAGGGATAACCGGACGTCTTGACAGGATCGAGGAGTCAC
AGACAAGGTTGATGGGTGCCAAGGAAACGTGTGAGAGACATATGTACACACCAATGACCCCGCCTAGACATTCAAGCTTGTTTGTTTTGGTCCTGGGAGG
GAGCACAAGGATGCACATAGAAAATTTTGGAAATGTTTTTAAATGCACCGGTATTTACTTCGAGGAGGCCGGTTGAAGGACATATTTCATTTGGCGCAGG
ACAACCCAAATATGGTGGTCCAAGGCCTACTGTTCATGCTCAAGTTGCTCCAGGACTTGGGATTCCGGGTACGTTGGTTGAAGGTGGAGGGCATGGATAT
ATGCAACACCAAGACCCAAATGGGAATGATCAAGGTCGTGAACACCTATTTCAAGTGAGTTAACCAGATACAAGACAAAATAAGCTTGGTATTCGACCAT
TTATGGACGTGAGCTGTACGAAGGTCTAGGCTCGGTTTTTTTCGGATGGGGTTGAAGATTCAAGTGATAAATTTCTTTGGCACAGTCGTCTTGTGAATAT
GAATGGCCGGAAGACGTGAAAATAAATTTGCTTGTTTTGTATCGCTATGGGAATGCAGACAGGTACTACAACAGAAAAGTTGCTATGTGGTGGAGTCAAT
TACCCACTTTGCAGTATATTACGGAAAAAATGATGGAAG