Description :
From Genome Similarity Track
Location :
Scaffold_440:12886- 15235
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_440-fgenesh-gene-0.760S ribosomal protein L21-1
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.14Pre-mRNA polyadenylation factor
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.15Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.23Gene of unknown function

Sequence
2349 bases(100 bases per row)
GGCATGCCCTTGTGGATGGCACCGTTGGCCTTGATGTCCACGTAGTCGCCGACCTTGAACGTACGCAGGTACGTCGACATCTTGACCATGCCGCTCTGGC
GGAACGGGCGCGCGAACATGTCGCGCGTGCGCGCACGGTAACCGAACGAGTGCGGCATGTTGGCAAAGTTTCTCCGAACTGCAGGACGAGCACCACATCC
CGTCAGTCAGTCTCCGCGTCTTCATACTCTACAACCAGCATCGGGGGAGGGGGGAAGGCGTCAGTGGGTGGGCAACCCAGACGCGCAGGCAGGCCGCATC
GCCTTGTATCTGGCTCATATCAGCCACGACTCCGCCGTGCTGCTCCTGTTCGAACGACGCGGCCGCCGCTGCTGCTGACGCCGCCACGCTGGTCGAATCG
CCGGCGCCAACCGCGAGGTCGCATGCCGCGCCTATAGCTGAGGCCCGCCCTGGCCGCCGCATTGCCCCTGCCCGTCCCCGCCCGCTGGCCAGAAAGCGAG
GCGCATTTACCTGCAAAGTCGAACGAGACAAGAAGGAACTGTCCGCTGCGAGAGCGCGGCGCTGAGCGGCTCGGTGCCCGCAAACTATTGGCCGGGAACG
CGCCAGTATACAAAGCGCAAGTCGGCCGCCGCCAGCCACTCACACTATCGGAAACCCGGCCCGCCAACCCGTCGCGAGCCATTCGACCCGGGTCGAACTG
TGTATAACCGTGTTGGTTACGAGGTAACCTAGGCAACCTCAGGAGGGGTACAAATGTAACCCGACCCATCAATTCTGGGGGAACGGGGACAACCAGGAGC
TCCGAGCAGCATGGAGGTCGGCGAGCGCGATGTGCTCGTTAGGCGGCGCCGGGAAGATGCACTGACTGTGGATTTACGCTGTTAGGACGAGGAGTTCGGC
GAGGACGTGCTGGTGGGCGGCGCGAAGGAGCCCGTGGTCAAGCCCGAGCCGGGCGGCGAGTGGGTCAAGGATGGACCTGCGCCGGCCGAAGAGAGCAAGC
AGGAGGCGGACGAGGATGACGAGCTGTACGGCGGCGTGTCCATCAAGCTCGCGGCTCCTCCGGCGTCAGGCTCCGCGCCTCCGCCCGCGGGATCGGTGCG
TTGTGAGGCTTTTGCATTGGTTGATGAGCTCCCAGCTAACGAAGATTTGGATCTCTTCGGACACACACACAGACCAGCAATCCAGCGGCGGCCAATGGCG
ACGAGGAGGACGACGAAGACGAGGAAGATGAAGACGTGGCGATTGTTCTGGGAAGCGGCGACGCGAGCGGTGCCAAGCCGACGCTGCGGTTCACGGGTGG
CGGCAACCGCTACGTTCGTGGCGGGTTCGCTGGCGGCGCGGCGGCGCACGGTCCTGGCGGACAAGCTGGCGCTGCTGGCGGTGCGACGGCGCATCTCCAC
GCCAAGCCAGGCGACCTGGGGGCAGAAGACGGCATCGATGACCTGGCCGTGTTCGGTGGTCGGCGCACGGCCTTCGACGTGGATATTGACATGCTCGAGG
AGAAGCCGTGGCGGAAGCCGGGCGTGGACATCTCGGACTACTTCAACTACGGCTTCGACGAGCACAGCTGGCGCGAGTACGCGGCGCGGCAGCTGCGCAT
GCGCCACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCGCGCGAGCAGGCAGCGCGGCAAGCTGTGAACGCCGCCAACCAGCAGG
CGGCGAGAAATTCAGGGATGCCGCCGTCGCGGGGGCCAGGGGACCAGAAGGGCGACGGCCGAGGGTCCAACGAGTGGATGAACATGCCGCCCGGAGGGAT
GCCGCGCGGGCCGCCGGGTCCAGGGGGCAATGGCGGAGGCGCTCCCCCACAAGGCATGATGCCTCCACCAGGGTGGCATCCAGGGATGGGTCCGCCTCCA
GGCTACTGGAACGGTCCACCTGGTCAATGGGGAAACAACGGCCCAGGATTCGGCGGACCGTGGATGGGGGACGACCGAGGAGGGCGAGGCGGCGGTCGAG
GTGGACGAGGAGGGCCGCGCGGACGAGGTGGCCGCGACTTCGACGACCGAGGACGCAAGGGTGGCGACGACCGAGGCGGCCCGCCACGCTCCCGNNNNNN
NNNNNNNNNNNNNNAGACCAGCCAGTCTGCCGCGCGCGACCGTTCTCGGTCCCGTTCCCGCCGTCGCGACGACCATCGTGGGGGAACGCGCGACGCGAGT
GGGCGAGATGCTGCTCGAGACCGCGAGCGAGGCGGCGCAGACCGCGGACGAGATCGCGACAGGGACCGCGACCGCGACCGCGAGCGTGACCGTGATCGAG
ACCGTGCTCGTGACCGCGACCGTGATCGCGACCGTGGACGCGACCGCCC